Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14090  (registered. 2002)
Contig Information
Length 1115 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 5
Wh_SL Seed DPA30 2
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit charged multivesicular body protein 4b [Zea mays]
Score 552
Evalue 1.67758e-54
Total Hit Count 394
Registered year 2002
Contig Sequence     [ Download ]
>Contig14090
gctttacccctTCTTCtccccagcCCGCTTTCACCAgagcgACTCCAgaaccaCGAGCCCCGCCGACGAAGCCGCCATCGCCAG*ACGCCGCCCCCGAGC
AAGAGGGGAGCGCCCCACTCCCGACATTCAAGCCGATCGGAGCGCGATCCGGCAGGTCGGAGCCCAGCCATGTCGGGGGTTTTCGGCAGGGTGTTCGGGA
AGTCCAAGGAGCAGAGCCAGGCGTCCGCGCTGGCCTCCATCGACAAGCTCAGCGAGACTCTTGAAATGTTGGAAAAGAAGGAAAATTTACTAATGAAGAA
GGCGAATCTTGAAGTTGAGAAGGCAAAGGCGTTCACCAAA*GCCAAGAACAAAAAA*GCTGCACTACAGTGTCTCAAGAGGAAGAGATTATATGAGCAAC
AGGTGGAGCAGCTTGGGAATTTCCAATTGAGGATTCATGATCAGATGATAATGCTGGAAGGTGCAAAAGCTACAACAGAGACTGTGGATGCATTGAGAAC
CGGAGCATCAGCAATGAAAGCTATGCACAAATCAACAAATATTGATGATGTTGACAAAACCATGGATGAAATTAATGACAATATGGAGAACATGAGGCAG
ATCCAGGATCTACTGTCTGCGCCTATGGGAGCAGCAAGTGATTTCGATGAAGATGAGCTGGAAGCTGAACTTGCGGATTTGGAGGGCGAGGAGTTGGAGG
CACAGCTACTAGCACCAACCACAAGTGCTCCTATGACTGCTCCAGCGCGTGTACCTCAGCAGTCGAGTCGGCCCACTGCTCAGAGTAGTAAAACCGAAGA
TGATGAGCTGGCAGCTTTACAAGCAGAGATGGCTATGTAGTTAGTTTGCAGGACTTGGGCGTGGGCATGTTTAGAGACCAGATTGTGCAAATATATTTGG
GACCACGGTATTTTCATGGAGGTCTTCCTGGGAAGACGTCAGAAGTGCACACAGAAACTAGTTGCATCTCACCCTGATGATCTCTTATGTATATCTT*AT
CATGTTACTTCTGTAATCAAACAtgcTAAGATGCGCTGTTGAGCGCATTATCAGCTAATAAAGGGCATCTGCCATCATTGTATATTTCTatttgtagcat
ttcaatatcgagtga
page-top