Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig512  (registered. 2012)
Contig Information
Length 993 bp
Clones alternative view 41 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 3
Wh_e Seed DPA10 2
Wh_r Root 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 4
Wh_VHS Shoot with heat shock treatment 4
Wh_VWD Shoot grown with dessication 3
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 4
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 3
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 5
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115446707|ref|NP_001047133.1|| Os02g0556800 [Oryza sativa (japonica cultivar-group)]
Score 279
Evalue 3.00E-73
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig512
CACTCACTCGTTTTCTGGTGTGTGTGTGTGTGTAAGGCTAGAGCAAGCGAGCGAGCGAGAGAGACTGAGAGAATTGAGAGAAGATGAAGATGGCTTGCCC
TGCCCAATCCATGCTCTCCGCAAGCAGCTGCGTGCTCCTCAGGAGCAGCAAGCCCCAGCAGGCCACGATTCCGCGAGGAGGAGGGGGCATCACCGGCGGC
AACAGGTTCTTGACGCTGTCCTGCAATGCTTCTTCGTCTCCGGACGACTCCGAGTGCAACGACGTGGAGTGCGCCCCGGAGAAGGAGGTCGGGAGCCTGA
GCGTGGAGTGGCTGGCGGAGGAGAGGACCAAGGTCGTGGGGACCTTCCCTCCCAAGAAGAAAGGATGGACCGGCCTCGTCGAGAAGGACACCGCCGGCCA
GACCAACATCTACTCCATCGAGCCGGCGGTGTACGTGGCGGAGAGCGCCATCAGCTCCGGCACGGCGGGGACGTCGTCCGATGGGTCCGAGAACACCGCG
GCGCTCACGGGCGGGCTGGCCCTCATCTTCGTCGCCGGGGCGGCGTCCATCCTCATCCAGGTGAGCAAGAACCAGCCGCCCGTGCAGACCCAATACTCCG
GCCCGCCTCTCAGCTACTACGTCGCCAAGTTCCAGCCGGCCGCCGCGGCATTCTCGGTCCAGTCGAGCCCCCCCGTTGTGGAACCGGCCGCGCCCGAGGA
GGCGCCTTCTGATTCACCCACCTTAGAGGCTGAACCTTCGGCAACCGCGGAGCAGCCGTCGTCGTGAGCTGATAATGATATACACGGTGAGCGTGAGACG
GAAATAATCGAAGCATAAATTTGATGTGGACGACGGGCACGAGCTTGTGTGTTAGCAATTCGATACAACGCTAGAGTTTGGAGAGTTTGAGGTGCCGTTC
TTCACTCATGAGTGAAGCCTACTCTTTATTTTGTATACGCGGTCTATGCCGGGTGGTTGGCTTGGCGTTCAGTTACTTATCTTGCATACCAGT
page-top