Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14034  (registered. 2002)
Contig Information
Length 1192 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 3
Wh_r Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Mcb1 protein [Hordeum vulgare subsp. vulgare]
Score 940
Evalue 1.88585e-99
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig14034
ttttttttttgcgatgcaagcACTGATAACATTAATTAAATTTGGTAACCATACATTACAAACAAACCTACTACACATATCCTCTCTGGTTTCCCTTCAC
CAACTTGTACCAAAGCAAGCAAATTCTTATGTATTTTACTCCATACACTAGCTGAAAAAGCTACTAGGACGATCGACGGGCAACAAGGTTAGCACGGCAA
CGAGAACAGGGGCGCCACATGAAGCTAAGCTGGTGGTGGTGCAGATCAGATCAATCCCTTCGGCCAGGCCTGGCAGCCGGGGGTCGATCACAGCACC*TT
GATGGCGTCGACCGCGCCGTAGCAGCGAGGAGGCGCGATGCTGAGCTCCAGGATGCTGCTGGCAGACGAAGACATTGCCAGCTCCAGCCCGGAGGCAGCC
ATGGCGGCCAGCGACGTCCCGGTGGGGAACTTTGATCTCTTCTTCACATGGTCAGTTAGTTCTTCAACCTGCATCTGGATGTTGTTGCTGTTGCCCCTGA
TGCCTCCAGGATAACTTGGTAGCGGCACGTCGCCGCGGTCGGTGTGGAGTATCTTCTCAGCAGGAGCAAGCTTGGTTCCAACACTCTGAGTACTTGGCAG
CTGATCGTCGTAGCTGTGGCCGGCGGGGATGCCGACGTCGAAGAGGCTGGCCCGGCGCTTCTTCTTGCCGGGGTTGGTCTGCCGGAGGAAGTACTTCTGG
GCGTGGCTGGCCACCTGCGTGGCCGTCCTGGTGGTGACGAAGTTCTTGGAGATGCCTCTCCAGTCCCCCTTGCCCAGCTGCTTCAGACCCTCCAGGAACT
TCCTGTGCTCCTCCTCGGTCcacggaATCCCTTTcttccgCTCCTGGGCCTTGCGGCGGCGGCGCTTGAGCTGCGGCGTGGACGCCAGCTCGCCGTCGTC
GGAGGCGTAGCCCTTGTCGTTGCTGGCCTCGCCGGGCAGGAGAATcggcgggctgttgGAGGCGCAGGCGAGGTTGGGCATGCTGGTGCTCTTCTTGAGC
TCCATGGGCTCCGCGTCATCCTCCTCCTCCGCGCCGCGGACCTCGACGCCGAACAGCCTGAAGAGCACCGCCTTCCTCGCGCCCTCCTCCTCCATTCCCT
CgcccgATGgtcgATGGAGCCGGGGGTTGcggggtCGCTGTCGCTGATGGAAGAGAGGTCGGATCAGGCGGAGGATGGTGGCGGTatcttgt
page-top