Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14029  (registered. 2002)
Contig Information
Length 1260 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 9
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_21886 [Oryza sativa Indica Group]
Score 905
Evalue 2.32138e-95
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig14029
atgatgtaattgactctttaTTTTattcngggaGGTGATCATATATGaggtACATCGATCAACTCCTATTCACATTACACTTATGCGAGTGAGAGAGGAA
CATCATGC*ACTCACT*CCCTACTATAAATTATTTAGTTGTTTGCAACCACTGCATGCGCCTCTAGTTCGGCGTCAGCCTCAGCATTGATCCTGACATTG
AGGAAGTCGACGGTGCGATCTCCCGCTGCAAATGCATCCCAATATCCATCGGCCAAGGTCTGGACCAGGCACTTCTTAAACATGGCCGGGTGCTTCTCAT
GAACCAGTACCCCCGGCGGCCCTATGATCCTCTCCGGCTCCGGCTGGTAGAACGTCGCCAGTGACAGCCTCTCCTTGTCGGCGCTCGTCACGACACGGTG
CCATGGCGCCTTGAAGATTGCATTGCTGACGATCTCCATGCCCTCGCCTACGACGACCAACAGGTCATTCCCGAGCACGGGGACATCAACCCAGTGGCCG
TCCTTGAGCACCTGGAGGCCGCCGACGTCCTTGTCCATGAGGAGCAGTGTGATGACAGAGTTGTCGATGTGTGGCTTCAGCCCGTTGACGAGGTCCGGCC
GTGGGCAGGGAGGGTAGTAGGTGAACCTCGAGTATGACTTGAACCTCTCACCCACCATGTTGATGAAGAAGTTCTCCTCCTGGTTCAGAAGCTTTGCCAT
GGCCTTCAGCACATCCATGGTCACTCTCCCACTCTCTAAGGTGTACT*CGTGTAGGGGATCCCTTAGATTCTGTGGCCAGAACTGGAGCCGCCTCTCGTC
CTCCGGCTGGAGCTGGAGCCAGAGCCGGTCACACCAGTCGAGGATCTGCTCGTCGGAGTCGATGCGGTCGATGCCGTACCCTTCGTTCTGGAacatgatg
cCGTCGATCACGTTGCCGCACTTCTGCTTCTCCTCCAGCGGCAGGTGGAAGAACTTCCTCGTCGCCTCGAGGATCTCGTCCAGGAACTCCTTTGGCATGC
CATGGCCGGTCACCACAAAGAGGCCCCATGACtgCAGCGCAGAGCGAAGCTTGGCCGCCTCCTCAACATCGTCGGGCATGGCCAGACGGCTCACGTCCAC
GATGGGGATAacCAGCTTGGCTTGCTGAGCGACAGTGGTCGGTCGGTTCTCCTCGCTTAGCACGTACCTgcTCGGCGGCGCCACAAGTCCAACGtccacg
GCCACCACCTGCACCAGCTTTCCCTGATCCTGATGAACCATCTTGACGCTagaataggtc
page-top