Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14021  (registered. 2002)
Contig Information
Length 605 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_yf Spikelet at early flowering 8
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RIX4-1 [Oryza sativa (japonica cultivar-group)]
Score 150
Evalue 2.17602e-08
Total Hit Count 153
Registered year 2002
Contig Sequence     [ Download ]
>Contig14021
gcctccctCTTCCTCTTCCTCATCACCacA*GCCGCTCTAGTCGTGGCGAATCTGACGCCTGCAGGCAG*ACGCAACAGGAGTTCGTGGAGCGGCGGATG
CAGACGGGGTCGTTGACGGAGCTGCAGGAGCAAGGAGCTCGAGTTGGTGCGCCATGAGGAGTGGAAGGCCGAGTTCGTGCGACGACCAGAGCAACAGGAG
CAAGGAGCCTCCTCTCTCTCCCTCTCAGTGGTTGAGGACTTCCTCAAGAAGAAAGAAGAAGGCCAAATAGAAGAAGAATTTGGCTCAAAGGTCTTGCGGA
GAGTGCATAATGTCCCCTCAGGTTTGAATTGCTCTGAAGTTATCATGGCATTTCCTTATAGGGCTTGTTCACATTTATTCATGGAAGGTGAACTACCTGT
TTCAAGATTGTAACCCACCTAAAAAATCCCTTCTGCCTT*CCTGTTTTTGTTTGTGTATGTCGCTCTGTAAAGATTGGTCAGCCTGACCATGAAAGGGTG
CTTCAGATTAGAAAAGAATGGTTTTTCTTTGTGTAATTTTCAGGACAAAGGAGGCTG*GGAGGAACTCATAAA*TGCCGTGCTAAATtattaattaaaaa
aaaaa
page-top