Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14011  (registered. 2002)
Contig Information
Length 1344 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 2
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 1
Wh_yf Spikelet at early flowering 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0173100 [Oryza sativa (japonica cultivar-group)] >gi|55773703|dbj|BAD72286.1| putative 26S proteasome regulatory particle triple-A ATPase subunit5a [Oryza sativa Japonica Group] >gi|113594984|dbj|BAF18858.1| Os06g0173100 [Oryza sativa (japonica cultivar-group)]
Score 997
Evalue 0
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig14011
gccgcaacctcccacAAATCTCCGCCTCCCCTCCCCTCCCCGGCCGCAGCAG*AGCGCCATGTCGTCCTCCCCTACCCCCGCGCCAG*ACGCCGGCGCCG
CCGCGATGGCCGTCGACGACTCGTCGGAGACCGACCAGCTCGACTCCATGTCCACGGAGGACATCGTCCGGGCCACCCGCCTCCTCGACAACGAGGTCCG
CGTCCTCAAGGACGAGCTGCAGCGGAACAACCTGGAGCTCGAGAACGTCAAGGACAAGATCAAGGAGAATCAGGAGAAAATAAAGCTCAACAAGCAGCTG
CCCTACCTCGTCGGCAACATCGTCGAGATTTTGGAAATGAACCCTGAAGATGAGGCTGAAGAGGATGGTGCTAATATAGATCTGGACTCACAGAGGAAAG
GAAAATGTGTTGTTCTTAAGACATCCACAAGACAGACTATATTCCTTCCTGTGATCGGGCTAGTTGACCCTGACAACCTCAAGCCTGGTGATTTGGTTGG
AGTCAACAAGG*ACAGCTACTTGATATTAGACACGCTACCTTCGGAGTATGACTCTCGAGTAAAGGCAATGGAGGTAGATGAAAAGCCTACGGAGGATTA
TAATGACATTGGTGGCCTTGAGAAAGAGATTCAGGAACTCGTTGAAGCTATAGTGTTGCCAATGACACAC*AAGGAGCAATTTCAGAAGTTGGGAATCCG
TCCCCCGAAAGGAGTTCTTTTATATGGATCACCTGGGACGGGAAAGACGTtgaatGGCTCGTGCATGTGCTGCACAAACCAATGCAACCTTTCTGAAACT
TGCTGGTCCGCAGCTAGTCCAGATGTTCATCGGTGATGGGGCAAAGCTTGTCCGAGATGCCTTTGAGTTGGCAAAGGAGAAGGCCCCCTGCATCATTTTT
ATTGATGAGAGGATAAAGGTGATAGCTGCAACCAATCGTGCAGATATTCTCGATCCTGCTTTACTCCGTTCTGGTCGCctggacagaaagattgagttcc
ctcatccgacggaagaagcaagagctcggattttgcaaattcactcaagaaagatgaacgtacatcctgatgtcaactttgaggagctggctcgttcaac
tgatgatttcaacggtgcacaactgaaggctgtttgtgtggaagctggcatgcttgctctacgcagggacgctacagaggtgatccatgaagatttcaac
gaaggcattatccaagtgcaagcaaagaagaagtccagcttgaattattacgcttagtttcccttgagtaatcagaacgcttggtcctgtgatggccgct
gtttgtaacactcggctaccatttttattggagtatagtttaag
page-top