Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14010  (registered. 2002)
Contig Information
Length 1453 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_h Spike at heading date 6
Wh_r Root 1
Wh_yd Spikelet at late flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit polyubiquitin [Zea mays] >gi|248339|gb|AAB21994.1| polyubiquitin [Zea mays] >gi|33323474|gb|AAQ07454.1| ubiquitin [Musa acuminata] >gi|52076878|dbj|BAD45891.1| polyubiquitin [Oryza sativa Japonica Group] >gi|218198760|gb|EEC81187.1| hypothetical protein OsI_24193 [Oryza sativa Indica Group]
Score 921
Evalue 0
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig14010
caggcaattcggcacgagggtccccctccgatctcaccgagaaatcgacgcgaaggctctctgcccgTCCTCAAGATGCAGATCTTTGTGAAGACCCTCA
CCGGCAAGACCATCACCCTCGAGGTCGAGTCGTCGGACACCATCGACAATGTCAAGGCCAAAATCCAGGACAAGGAGGGCATCCCTCCGGACCAGCAGCG
TCTCATCTTCGCTGGCAAGCAGCTTGAGGATGGCCGCACCCTTGCTGACTACAACATCCAGAAGGAGTCCACCCTCCACCTGGTGCTCAGGCTCCGTGGT
GGCATGCAGATTTTTGTGAAGACCCTCACCGGCAAGACCATCACCCTTGAGGTCGAGTCCTCGGACACTATCGACAACGTCAAGGCTAAGATCCAGGACA
AGGAGGGCATCCCTCCGGACCAGCAGCGTCTCATCTTCGCTGGCAAGCAGCTCGAGGATGGCCGCACCCTTGCTGACTACAACATCCAGAAGGAGTCCAC
CCTCCACCTGGTGCTCAGGCTCCGTGGTGGCATGCAGATTTTTGTGAAGACCCTCACCGGCAAGACCATCACCCTGGaggtCGAGTCCTCTGACACCATC
GACAATGTCAAGGCgaAGATCCAGGACAAGggaGGGCATTCCCCCCGGACCAGCA*GcgcctCATCTtcGCTGGCAAGCAGCTCGAGGAtggccgCACCC
TTGCTG*ACTacaATATCCAGAAGGAGTCCACCCTCCACCTGGTGCTCAGGCTCCGTGGTGGCATGCAGATTTTTGTGAAGACCCTCACcgg*caaaagA
CCATCACACTTGAGGTTGAGTCCTCGGACACAATTGAcaacgtg*aAGGCTAAGATCCAGGACAAGGAGGGCATCCctccgGACCAGCAGCGTCTCATCT
TTGCTGGCAAGCAGCTCGAGG*ATGGCCGCACCCTGGCTGACTACAACATCCAGAAGGAGTCCACCCTCCATCT*GGTGCTCAGGCTCA*GGGGTGGCAT
GCAGATCTTTGTGAAGACCCTGACCGGCAAGACCATCACCCTGGAGGTTGAGTCCTCTGACACCATCGACAACGTGAAGGCAAAGATTCAGGACAAGGAG
GGCATTCCCCCGGACCAGCAGCGCCTGATCTTTGCTGGCAAGCAGCTTGAGGATGGCCGCACCCTGGCGGACTATAACATCCAGAAGGAGTCCACCCTTC
ACTTGGTGCTCCGTCTCCGTGGTGGCCAGTAAGTACCTGGCAATGGAGCGGCTTCTGTGCGGGTTCACAGGTCTTGTGTCTTCGGTATGGCCTCCAATGG
TGCCTGTGTCTGTTGTCCTGGTCGTTTCTTTGTTTCTACCGTACTGTGATGCATCGTTATGTTCAGTTGTATTTGAAAACTAAAGCTGTTGTGAAGCAGC
TTTGGTGAACTTGATAAATAAGTGAGGCCTGAATTGTGTCTGcaaaaaaaaaa
page-top