Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14004  (registered. 2002)
Contig Information
Length 650 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 1
Wh_h Spike at heading date 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 60S ribosomal protein L44 [Zea mays] >gi|195606184|gb|ACG24922.1| 60S ribosomal protein L44 [Zea mays] >gi|195620316|gb|ACG31988.1| 60S ribosomal protein L44 [Zea mays] >gi|195623550|gb|ACG33605.1| 60S ribosomal protein L44 [Zea mays] >gi|195656257|gb|ACG47596.1| 60S ribosomal protein L44 [Zea mays]
Score 422
Evalue 7.47493e-40
Total Hit Count 334
Registered year 2002
Contig Sequence     [ Download ]
>Contig14004
aaaccagaaacatatacaGTCCTAATGGGaccagtAACAAACATAACGAACTCAAAAGCAGAAAGAACATTTTTACTTGTCTCAAGG*ATCTGAAGAGAG
TCGTTGACAGGAAAGGCAAAACATATGCTCCATAGCCCATACAGTTATACCCAG*AATACCAATATGATACTAATACATTGTTCGAGTGGGAAGTTCTGG
CACAACACTGAACAAAACAGGGATATCATCAGCTTAGAAGAGAGAGGTCCCCTTGCCCTTCTTGTCTCCACCGATCTCAAAGTGCTTGCACCTCTTGATA
GCGCGTTGCGAGTAATGCTTGCAGCTCTGGCACTGCAGCTTCAGCACAATCTTCTTTGTTGTCTTGGCCTTCTTGTGGAAAACAGGCTTTGTCTGGCCAC
CATATCCTGACTGCTTGCGGTCGTAACGGCGCTTTCCCTGAGCAGAAAGACTGTCCTTGCCTTTCTTGTACTGCGTAACCTTGTGGAGGGTGTGCTTCTT
GCACT*CCTTGTTCTTGCAGTAGGTCTTCTTGGTCTTTGGAACGTTCACCATGGTCGCCGCCTGGAAGCTCTCCTCCGCGCGTCTGCTTCTTCT*CCTG*
CGGCGTGGGCGGCGGTGAGGAAAGGGGG*AAGGGGGAgcctcgtgccgaa
page-top