Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13970  (registered. 2002)
Contig Information
Length 698 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_dL Crown of seedling 4
Wh_oh Pistil at heading date 1
Wh_r Root 2
Wh_yd Spikelet at late flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100216638 [Zea mays] >gi|219363539|ref|NP_001136445.1| hypothetical protein LOC100216551 [Zea mays] >gi|194694728|gb|ACF81448.1| unknown [Zea mays] >gi|194696028|gb|ACF82098.1| unknown [Zea mays] >gi|195619128|gb|ACG31394.1| histone H2A variant 3 [Zea mays]
Score 538
Evalue 3.08436e-53
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig13970
tcggcacgaggaaAAAATCTCTCCTCGCTCTCGTCCGAGTCGCGTGAGGAGAAAGGAGGGAAGCCGGAAAGGGGTTCTCGCCGAGGCGGAA*GGAGGAGA
TGGCCGGGAAGGGAGGCAAGGGCCTGCTCGCGGCCAAGACGACGGCCGCCAAGACCGCCGAGAAGGACAAGGGGAAGAAGGCCCCCATCTCCCGCTCGTC
CCGCGCGGGACTTCAGTTCCCTGTGGGCCGTATCCATCGTCAGCTGAAGCAAAGGACTCAGGCCAATGGCCGTGTTGGTGCTACTGCGGCGGTCTACTCT
GCTGCCATCCTGGAGTACTTGACGGCTGAGGTCCTGGAGCTGGCTGGCAACGCCAGCAAGGATCTCAAGGTGAAGCGTATCACCCCTCGTCACCTCCAGC
TGGCCATCCGTGGAGACGAGGAGCTCGACACCCTCATCAAGGGCACCATTGCTGGTGGAGGTGTGATCCCGCACATCCACAAGTCCCTGATCAACAAGTC
TTCCAAAGAGTGAGAAAATATATAGCAAAGGAGCATCTCTAGCTTAAACTGGACATTTTCTCAGTCGTCTGTGAGATAAGTTTATCGTCGCGTCGTTTAG
CGTTTAGCTGTGCTCCTTCCAGATCCAAGTCGTTGTCTGTCTGTGTAATGTTTACCTGGTActatTCAGTCatttggacatggtgtttatgtggttcg
page-top