Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5108  (registered. 2012)
Contig Information
Length 911 bp
Clones alternative view 229 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 17
Wh_dL Crown of seedling 12
Wh_e Seed DPA10 3
Wh_f Spike at flowering date 6
Wh_h Spike at heading date 9
Wh_oh Pistil at heading date 3
Wh_r Root 3
Wh_yd Spikelet at late flowering 5
Wh_CSEC Callus 11
Wh_DPA20 Seed DPA20 10
Wh_EM Dormant seed with water absorption 8
Wh_EMI Dormant seed with water absorption after breaking 11
Wh_KMP Shoot grown under continuous light 3
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 9
Wh_PCDAM Anther at meiosis 3
Wh_RDr Root of dessiccated seed 6
Wh_SHC Shoot grown with cold treatment 9
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 9
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 3
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 3
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 4
WH_XA Root 12
WH_XB Root 14
WH_XC Root, treated at 50 microM Al for 6h 15
WH_XD Root, treated at 50 microM Al for 6h 11
WH_XF Seedling, infected with leaf rust 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 8
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|48596901|dbj|BAD22763.1|| ribosomal protein [Bromus inermis]
Score 432
Evalue 3.00E-119
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5108
TTTTTTTTTTGCAATTTTAACTTTGAAGAGAGCTTTTATCAGATAATGGCTAACTTAGATCTCAAACATTTAAGGTAACCGGATGAGGTCTCGAAATAGC
GCTTAATAAGGTAAACATCCACATTACATCTAGCAGCAACCACGAGTTCGCAAATCAACAAACATCAGGCAAAACTTAAAAACGATGGTTCCAGGAACAT
AGGTCTATATCCTTGCAGATAACTGGCTATAGCAAAACGACTCAACACCTCAGAATCAGGCCTTGGCAGCAGCCTGGGCAGCGGCATCCCGCTTCCTCTG
CTCCTCAATGATGGTGAGCTTGATACCCTTGCCCTTGGGGAGGCTCACCCACGGCTTGGTGCCCTTGCCGATGGTGAACACGTTGCCCAGACGGGTGGCG
AACTGGTGGCCCTGGGCATCCTCAACGTGGATGGTCTCGAAGGTTCCCTTATGCTTCTCCCTGTTCTTGATCACACCAACACGCCCAGTGTTGCGCCCAC
CAGTCACCATGACCACGTTGCCGACGTCAAACTTGATGAAGTCAACAATCTTGTTGGTCTCCAGGTCAAGCTTGATGGTGTCATTGGCCTTGATGAGTGG
GTCTGGGTAGCGGATGGTGCGGCCATCATAGGTGTTGAGGTATGGGATGCCCTTCTGGCCAAACTGGACAGACCTGACCTTGCAGAGCTTGAACTTAGCA
TCCTCGTCCCTGACAGAGTGAAGGCGGAAGCGACCCTTGGTGTCATACAGAAGCCTGTAGTTCTCACCAGTCTTGGGAATGGAAATGATGTCCATGAAAC
CAGCAGGGTAGGTCTTGTCAGTGCGGACCTTTCCATCAACCATAATATGACGCTGCATAAGGATAGATTGCACTTCACGGTAGGTGAGAGCATATTTCAG
TCTGTTCCTCA
page-top