Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13907  (registered. 2002)
Contig Information
Length 1048 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_oh Pistil at heading date 1
Wh_yf Spikelet at early flowering 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit IN2-1 protein, putative, expressed [Oryza sativa (japonica cultivar-group)]
Score 886
Evalue 2.83329e-93
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig13907
ttaagaAAAgttncgagcattcaGCACAACTCag*AATGATCAtcC*TTTACGAG*ACAATAAAAGTTTACAATAAG*ACCCAGTTTGTCTGTTTATTCT
CTATATAAAAGCATGGCCTATATGCATGGCATGCATCTTTTATTCAAAATATATTGCAACACCCCCGAGTCTAAATCTGCTATTCTGCAGCGATTCCCTG
GCATGCATATTTGGTTATCCTTGGTCACATCTTCAAGCAATCCCAAACTTCTCCTTCATTTGATCAAGTAGAAACTGTGGGTCCAATTTGGTCTGTGTAT
ATGCGTCGACCTTGTTCACTTCCTCAATGAATTTGTGCAGGTTGGGCCTTCCCTTGGCAAGATCATCCTTCTTGATACCAGAATAGAATATCTGAAACCT
TTCGATGAATGGTACATACGCAATGTCCACCAAACTGAATTGGTCAAGGAAGAATGGGCCATCGCTGAACTTCAAGGCAGCTTCTATTTTATCCACAGCA
GCAGCGGCTTCATTTGACACATCTCCCTTGGAGCGTAAGCATGAGAAAAATGCACTATTAAACCCATCGCTGAACGCAAGCAGTTCCTCAGCAAACTGCT
TCTTTGCAGAATCATCAGGCAGCAATGCTGGGCCATCAAAATTGCTGTCAATGTACTTGACCAAATCCAAGCTCTCTCCTTTCACCTGGTTGTTATGCTC
CAGGGCAGGCACCTTGTTCTCCGGGTAAACTTTCTCCTTGTACCAAGCTGGCCTGTCCGCCAGATCTATGGCGACTACCTTGATCTTGTCCTGTAAACCC
TTGCAGTTCCTGGCAATCCAAGCGCGCTGCGCGTACGGACAGTGATATGCAAGATACAGCCTGGTGGTGCCGTCGAAGAGCGGAGGGGGCTCGGAGGCGG
AGGTCAGTGGAGGGGGGAGATCTTCCTTCGGGGAGATGATCGGTGGAACGGCGGTTGCCATGGCGACGGTTCGGGAGGAATGTCCCGGCGGTGCTGGGGG
ACGGGAAGGTGAGAATGGGAGATCGAGGAGGAGGCagcctcgtgccga
page-top