Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13902  (registered. 2002)
Contig Information
Length 645 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_e Seed DPA10 7
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit dimeric alpha-amylase inhibitor [Triticum aestivum]
Score 766
Evalue 9.65e-80
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig13902
aggaattcggcacgaggcTGAGCGCAGAGGAACAATGTCGATGAAGACCGTGTTCTCGGTGCTCCTGCTATGTATGCTCGTGGCGACACCC*ATAGCGGC
CGAGTACGACG*CATGGAGCGTTAACAGTGGTCCCTGGATGTGCTATCCAGGGTATGCCTTTAAGGTGCCAGCGCTCCCTGGCTGTCGTCCAGTGCTGAA
GCTCCAGTGCAATGGCAGCCAGGTGCCCGAGGCTGTCCTAAGGGAGTGCTGCCAGCAGCTCGCCGACATCAGCGAGTGGTGCAGGTGCGGTGCCCTCTAC
AGCATGTTGGACAGCATGTATAAGGAGCATGGCGTGCAGGAGGGACAGGCGGGGACAGGCGCGTTCCCAAGCTGCCGGAGGGAGGTGGTGAAGCTGACGG
CGGCGAGCATCACGGCGGTCTGCAAGCTACCCATCGTCATTGATGCGTCTGGAGATGGAGCGTATGTCTGCAAGGGTGTGGCCGCATACCCGGACGCCTA
GTCAAGCGAATGAGTAGCTACTATGTTGTGTCATGCATCTGCCTCTTAATTTGTGGGGTGCGCACAAGTTGAATAAAATGGTGTATGCGCCTATGCGAAA
TGCATCATTAATGAATAAAAGCGAAGTTCCCTGTtaaaaaaaaaa
page-top