Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13835  (registered. 2002)
Contig Information
Length 703 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_e Seed DPA10 2
Wh_oh Pistil at heading date 1
Wh_r Root 1
Wh_yd Spikelet at late flowering 1
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100216638 [Zea mays] >gi|219363539|ref|NP_001136445.1| hypothetical protein LOC100216551 [Zea mays] >gi|194694728|gb|ACF81448.1| unknown [Zea mays] >gi|194696028|gb|ACF82098.1| unknown [Zea mays] >gi|195619128|gb|ACG31394.1| histone H2A variant 3 [Zea mays]
Score 538
Evalue 3.14605e-53
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig13835
cagagtcaACGAACCAACATAAACACCATGTCCAAATGACTGAAT*AGTACCAGGTAAACATTACACAGACAGACAACGACTTGGATCTGGAAGGAGCAC
AGCTAAACGCTAAACGACGCGACGATAAACTTATCTCACAGACGACTGAGAAAATGTCCAGTTTAAGCTAGAGATGCTCCTTTGCTATATATTTTCTCAC
TCTTTGGAAGACTTGTTGATCAGGGACTTGTGGATGTGCGGGATCACACCTCCACCAGCAATGGTGCCCTTGATGAGGGTGTCGAGCTCCTCGTCTCCAC
GGATGGCCAGCTGGAGGTGACGAGGGGTGATACGCTTCACCTTGAGATCCTTGCT*GGCGTTGCCAGCCAGCTCCAGGACCTCAGCCGTCAGGTACTCCA
GGATGGCAGCAGAGTAGACCGCCGCAGTAGCACCAACACGGCCATTGGC*CTGAGTCCTTTGCTTCAGCTGACGATGGATACGGCCCACAGGGAACTGAA
GTCCCGCGCGGGACGAGCGGGAGATGGGGGCCTTCTTCCCCTTGTCCTTCTCGGCGGTCTTGGCGGCCGTCGTCTTGGCCGCGAGCAGGCCCTTGCCTCC
CTTCCCGGCCATCTCCTCCTT*CCGCCTCGGCGAGAACCCCTTACCTTTCCGGCTTCCCTCCTTTCTCCTCACGCGACtcggacgagagcgaggagagat
ttt
page-top