Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13821  (registered. 2002)
Contig Information
Length 834 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_yd Spikelet at late flowering 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0708000 [Oryza sativa (japonica cultivar-group)] >gi|19387250|gb|AAL87162.1|AF480496_16 unknown [Oryza sativa (japonica cultivar-group)] >gi|41053161|dbj|BAD08103.1| unknown protein [Oryza sativa Japonica Group] >gi|113537409|dbj|BAF09792.1| Os02g0708000 [Oryza sativa (japonica cultivar-group)] >gi|125540837|gb|EAY87232.1| hypothetical protein OsI_08634 [Oryza sativa Indica Group] >gi|125583407|gb|EAZ24338.1| hypothetical protein OsJ_007821 [Oryza sativa (japonica cultivar-group)] >gi|215766378|dbj|BAG98606.1| unnamed protein product [Oryza sativa Japonica Group]
Score 582
Evalue 3.47811e-58
Total Hit Count 16
Registered year 2002
Contig Sequence     [ Download ]
>Contig13821
actGCTTGATGGGTTTAATGTACAAAATacaat*ctGGAAGTGACTGGGAACTAGTACAAACTTTGCAGAGCGCGCCCCAAAACTAGAGTGAAGAACGAA
AACGCTATGATCGCCGATGGATCATGGATGCCTAGCAAATTGCCTAGCAGACACTCTTATCATATGATGAGATACATCAAGTTGTGAACCTAAGCTACTG
TGATGATCATGAACCGGGCTTTGCGGAGACGAATGTTCCGCCCCTTACTTGCCCTTGCCTGACGGCGCCGTTGGCAGCCGCGGGGTACCTGAAACCGGCG
TACTCCTTCGGAATACCGGCCTGGTGGTGGTGGTGCTGCTGCTGCTGCTGGCGCCCTCTGTTGTTGGCCTTGGCGTCGGTCTTCCACGCCGCGGGCTTCT
CCGGCGCGAACTTGATCTCGAAGCCGTCGTCCATGTCATGGACCACCGCGCGGGAGCTTGGCATGGGCTTCATCGGCGGGTACTTGACCTCGAAGCCCTT
CTCCAGGTCGCCGCCGACCGCGTTGGTGCCGTAGTAGTGCTGGTCGGCGTAGGCCTTCTTCTTGGAGAGCCGGCGGCCGCACAGCCGCCCCGCGACGCAG
GCGACGACGGCGAGGAAGGAGATGACGCCCAGCACGGTGAACACCGGCGCGAAGGAGCCCCTGGACGTGGTGGCCGGCTGCGCGTGCATGATGGGGTTGG
TGGTGGGGTAATACGGCATGGGCTGAGTCATGGAAGCCATGGCAGCTTCTTCTCTCTGCTGCCTCTCAGCTCTCGAGAACTATTCTCTGTTTCTCAAGGA
AGGgaatgaAATGgccctcgtgccgaattcctgc
page-top