Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5095  (registered. 2012)
Contig Information
Length 2748 bp
Clones alternative view 93 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 3
Wh_r Root 1
Wh_yd Spikelet at late flowering 1
Wh_CSEC Callus 4
Wh_DPA20 Seed DPA20 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_RDr Root of dessiccated seed 5
Wh_V483 Shoot grown under cold condition for 3days 11
Wh_VSCB Liquid cultured tissue 3
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 3
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 5
WH_XN Leaves, plant was grown at constant 23 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 6
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 22
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XE Seedling, infected with leaf rust 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|401138|sp|P31922.1|SUS1_HORVU|SUS1_HORVU RecName: Full=Sucrose synthase 1; AltName: Full=Sucrose-UDP
Score 1597
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5095
GCCATCCATCTTGCTCCCTTCCGTCGAGTTCGTTCGTGGCGTGTTCTTGCCAAGTTTTGTGACCTGAGCCATGGCTGCCAAGCTGACCCGCCTCCACAGC
CTCAGGGAGCGCCTTGGTGCCACCTTCTCCTCCCATCCCAATGAGCTCATTGCACTCTTTTCCAGGTATGTTCACCAGGGCAAGGGCATGCTTCAGCGCC
ACCAGCTGCTTGCTGAGTTTGACGCCCTGTTCGAATCCGACAAGGAGAAGTATGCACCGTTTGAGGACATCCTCCGTGCTGCGCAGGAAGCAATTGTGCT
GCCCCCATGGGTTGCACTTGCCATCAGGCCCAGGCCTGGTGTCTGGGACTACATTCGGGTGAATGTTAGTGAGCTCGCTGTGGAAGAGCTGACTGTTTCT
GAATACTTAGCATTCAAGGAGCAGCTTGTCGACGAGCATGCCAGCAGCAAGTTTGTGCTAGAGCTTGATTTTGAGCCTTTCAATGCCTCCTTCCCGCGCC
CTTCCATGTCCAAGTCCATCGGAAACGGGGTGCAGTTCCTTAACCGTCACCTGTCTTCCAAGTTGTTCCAGGACAAGGAGAGCCTCTACCCACTGCTCAA
CTTCCTGAAAGCCCATAACTACAAGGGCACGACAATGATGTTGAACGACAGAATTCAGAGCCTTCGTGGTCTCCAGTCAGCCCTTAGGAAGGCAGAAGAA
TATCTAGTTAGCATTCCTGAAGACACCCCCAGCTCTGAATTCAACCACAGGTTCCAAGAGCTTGGCTTGGAGAAGGGTTGGGGTGACACCGCAAAGCGGG
TACACGACACCATCCATTTGCTTCTGGACCTTCTTGAGGCCCCTGATCCTGCCAGCTTGGAGAAGTTCCTTGGAACTATTCCGATGATGTTCAATGTTGT
CATCCTGTCACCGCATGGATACTTTGCTCAATCCAATGTGTTGGGATACCCTGATACCGGTGGCCAGGTTGTGTACATCTTGGATCAAGTCCGGGCTTTG
GAGAATGAGATGCTTCTGAGGATTAAGCAGCAAGGCCTTGATATAACTCCCAAGATCCTCATTGTAACCAGGTTGTTGCCTGATGCTGTTGGAACCACAT
GTGGCCAGCGGCTGGAGAAGGTCATTGGAACTGAGCACACTGACATTCTCCGTGTTCCATTCAGAACTGAGAATGGGATCCTCCGTAAGTGGATCTCGCG
TTTTGATGTCTGGCCGTACCTGGAGACATACACCGAGGATGTTGCAAACGAACTCATGAGGGAAATGCAGACCAAGCCTGATCTCATCATTGGTAACTAC
AGTGATGGTAACCTTGTGGCCACTCTGCTTGCACATAAATTGGGAGTTACCCAGTGCACCATTGCCCATGCCTTGGAGAAAACCAAGTACCCCAACTCAG
ACATATATTTGGACAAATTTGACAGCCAGTACCACTTTTCATGCCAATTCACAGCTGACCTGATTGCCATGAACCACACTGATTTCATCATTACCAGCAC
ATTCCAGGAAATCGCTGGAAGCAAGGATAGCGTGGGCCAATATGAGTCTCACATTGCTTTCACCCTTCCTGATCTGTACCGGGTTGTCCATGGGATTGAT
GTGTTTGATCCTAAGTTCAACATCGTCTCTCCTGGAGCAGACATGACTGTCTACTTCCCATACACCGAGACTGACAAGAGGCTCACTGCCTTCCACTCTG
AAATTGAGGAGCTCCTGTACAGCGATGTTGAGAACGATGAACACAAATTTGTGTTGAAGGACAGGAACAAGCCAATCATCTTTTCAATGGCCCGTCTTGA
CCGTGTGAAGAACATGACTGGCTTGGTTGAGATGTACGGCAAGAATGCTCATCTGAAGGATTTGGCAAACCTTGTGATTGTTGCTGGTGACCATGGCAAG
GAGTCCAAGGATAGGGAGGAGCAGGCTGAGTTCAAGAGGATGTACAGTCTCATTGAGGAGTACAAGCTGAAGGGCCATATCCGTTGGATCTCTGCTCAGA
TGAACCGTGTTCGCAATGGTGAGCTGTACCGCTACATCTGTGACACCAAGGGAGCATTTGTGCAGCCTGCATTCTATGAAGCATTTGGTCTGACTGTCAT
TGAGGCCATGACATGTGGTTTGCCGACAATTGCGACATGCCACGGTGGCCCTGCTGAAATCATTGTGAACGGGGTGTCTGGCCTGCACATTGATCCTTAC
CACAGCGACAAGGCCGCAGATATCCTGGTCAACTTCTTTGAGAAGTGCAGCGAGGATCCAAGCTACTGGGACAAAATGTCTGAAGGAGGCCTGAAGAGAA
TTTATGAGAAGTACACCTGGAAGCTGTACTCAGAGAGGCTGATGACCCTGACCGGCGTGTATGGGTTCTGGAAGTACGTGAGCAACCTGGAGAGGCGCGA
GACTCGCCGTTACCTGGAGATGTTCTACGCTCTGAAGTACCGCAGCCTGGCTGCTGCAGTTCCATTGGCAGTTGACGGCGAGAGCTCCGACAACTAGCGC
GGTGCAATGGGGCATGAAGAGGCGCATTCAGCGGGAGGGTGAAGTGTCGGCTGCGTTATGATTTGTCTGTCTACCGTAGTTTCCATTTGGTCTGGTCGTG
GGGTGTGTTAATTTGTTGTCCCGGCACATTTGTGAGGTCCTGGGCAGTGCTCGCTGGTTCATGCCAGCCGCATTTGTTGCGTGGAATAAACGCCTGCCCA
TATTGTTCATCTTTCATCAGAGTTCAATGCAATGTTTCGTTGTCTGTC
page-top