Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13801  (registered. 2002)
Contig Information
Length 1177 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_dL Crown of seedling 1
Wh_r Root 4
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit phosphoglycerate mutase-like protein [Zea mays]
Score 1235
Evalue 1.1432e-133
Total Hit Count 225
Registered year 2002
Contig Sequence     [ Download ]
>Contig13801
aggaattcggcacgaggccgcCTCGGGCCGCTGCCTCTGCCTCATCGTCCTCCTCGCGCTCGCACTCCTTCGCCGCTGCCGGACGGGTTTCCCTCCGCCG
TCGCCGCCGCCGCGCTTCCTTCACCGACTGCCGCTGCTCCTCCTCCTCCTCCCCAGAAATGGAGGCCGGCGCTGGCACGGCTCTGTACCCCGCGCACCGA
TGCAAAACCATATACCTGGTGAGGCATGCCCAGGGTATTCACAATGTGGAAGGCGAGAAGGATTTTGCAGCATACAAGTCACATGCGCTGCTTGATGCTC
AACTTACCCCTTTGGGCTGGAGCCAAGTTGATACCCTGCGAGATCATGTGACAAAATGTGGACTAGCAAAAAAGATTGAGTTGGTTATTGTTTCCCCTCT
ACTCAGGACTATACAAACTGCAGTGGGGGTCTTTGGTGGTGGGAACTATATTGATGGAGCAAGTGCATCACCATTGATGGTAGAGGGTGCTGGAAACAGT
GAACGTCAGCCGATTTCAAGTTTGAACTGCCCACCGTTTCTCGCAGTTGAGGCTTGCAGAGAGCACCTGGGTGTTCATCCCTGTGACAAGAGGAGCAGCA
TAACAAAATACCGTACTCTCTTTCCTGCCATTGATTTTTCC*TTGATCGAGAATGATGAAGATGTTCTCTGGGAACCCGATGTCAGAGAAACAAATGAGT
CTGTTGCTCTCAGGGGCATGAAGTTCTTTGACTGGTTATGGACGAGAGAAGAGAAAGAGATAGCTATTGTCAGCCATAGTGGTTTCTTGTATCACACCTT
GAACATGTATGGTAAAGAGTGTCATCCAACAATAGCAGAGGAACTGGGAAAGCACTTCGCCAACTGTGAGCTCCGGTCGATGGTCTTGGTCGACAGAAGT
AACCTTGGATCGGATGCCTCTAAATACAACTTCGCTGGGAAGATACCGACCGGGCTTGATATGCCCAGCGATGTCGCAGACGAGAAGCAGGCTGAAGAAG
CTAGCAAGAACTGAGGCTGTCGAGCATGTGGATGTCTTTGATTCTTTTGTCAAACCTTGGTTCTGGCTGACAATGAACTGAGAATAGATACTAAGCGACA
TCTAAGGATAGGACTTGCCGT*CTGTTGTT*CCGGTGTATGATGGGCACGAT*GGTTATGTTTAtctatTTGTTgtt
page-top