Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13780  (registered. 2002)
Contig Information
Length 1064 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_yd Spikelet at late flowering 5
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0352300 [Oryza sativa (japonica cultivar-group)] >gi|108708152|gb|ABF95947.1| Nucleolar protein Nop56, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113548593|dbj|BAF12036.1| Os03g0352300 [Oryza sativa (japonica cultivar-group)] >gi|125586258|gb|EAZ26922.1| hypothetical protein OsJ_010405 [Oryza sativa (japonica cultivar-group)]
Score 831
Evalue 6.855e-87
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig13780
ttttttttttaccagtgccaacaatgccattccatttaTATAGGAAAGCTAAgccatcCCCAAG*AAACGACATACTGCAACATCAAATGTATTACAGAT
ACGCCGCTTCAGTCCATGAAGCTACATTACAGACCTCGTCAAGGGCTCAAAGAGGCTCAAAGAGTACACACTTAAACAGTCGGTACAAAAAATTTCATCC
TCAATCGACTTGAACACTCGCTGCTAGGTACTTAGGTACTAATCTACTACTCGTCGTCATCAGCCTTGGATTTCTTCTTCTTTTTCTTGGATTTCCCCTC
GGTGCCCGTCTTAGGATCAACAGACTCGGCGTCGCGGTT*CTTCTTTTTCTTCTTCTTAGGGGTCTCATCATCGCCATTGGCTTGCATCTCCACATCCTG
CGGCTCCTCAAGCTTGTGCTTCTTTTTCTTCTTCTTCTCGGTTCCAGTTTCAGCTTCTGTTGCGGCATTCTCAACGTCCATCGCATCACTGTTAGCCTCA
GCTTTGGACTTCTTCTT***GCTTTTCTTCACAGATGCGTCACCATTCTCTTTGCCGTCATCATCCTCTGTGTTTGTCAAGCCATCAATAGCAGCTTTCA
TCACATCAAGGTTCTTGCGGGGTGCAACACCCTTATCGTAGAAATCTAGCCTCTCCTCAACTTGTTCACGCAGCTTCTCACCAAAAATGGAGCTACTCAT
ATCTGAATAGCAGTCAATACGTGAAGCAATGGAA*CATTTGTTTGCAAGGTATCGAGCCATCCTTCCCTTGTTCTTGGTTGATGCACGACCAATAAAAGA
TGAGTGGAATATGAGGCCATACTTTGGTGTGTTTCCACGTGTTTTCAGAGCTCTGAAGAGTGCCTTTTCAGCACCCAGTATCTGCAGAGTAGAAGCAGGG
CATTTTGCAAGATTTGAAAGACTGCCAGCATGAGAGATTAGCCGAGCT*CCAACCATTTCACCAATCAATGACgt*CAGGTTTGGAGCAatgtcATTCAt
ctttgtcaccagatactcatagagatttttacggtactcagatagattcatgaccctctgagca
page-top