Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13709  (registered. 2002)
Contig Information
Length 687 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 8
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_08879 [Oryza sativa Indica Group]
Score 346
Evalue 5.57308e-31
Total Hit Count 185
Registered year 2002
Contig Sequence     [ Download ]
>Contig13709
gccctccctatcgccttgctactacttcgggtccgagaacgaagccatttttgcatctccgcgagcgacttgagaggccgggaTCGGCTTTGCAGCGTAG
GAAAATGAAGAGGCTGCTCGTTCATGGCCGGAGGGGAATCAGCTGCCCCTCCAGGAGCGCGGCGGGAGATCCCTCCGCCCTGCCCGCGCTTGGCAACAGC
GTTCTACTGCCCAGGTACCACTCGACAGAGAAACACGACGACAGTGACACGCTGGGCGAAATCGGAGAGAAGGCAAGAACGACGGCGGAGGAGTTCCTGA
AGATGGCCAAGGAGAAGACCGACGACGTCGCCGAGGGCGCAAAGGAGACGGTGCAGGAGACCAAGGAAGCGGTGCTCGGCGAGTCGGACGACGAG*AAGG
AGAAGTTCAAGCAGAGGGTCGAGCAGGGGAGGTACCATCAGAAATAAGTGGCGGCTGCTCCGCTGCACTGCCTCTATACTTGCACGCAGACAGACATGGC
CTGTCGAGGTCGTTAGCTCTGCAGTTTGTATGTCGTCAACCACTAGGTTTGGTATCTAGGTGCTATGTGTAATGTTTCTTCCCCCTTCAGTTCAGTGGCC
TTCAGTACTACAATGTGATCTTGGTGCTATACAACTTGCCACTTCCCGCAGAATAAATAATGCTGAGCCTCTGAATtaaaaaaaaaa
page-top