Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5083  (registered. 2012)
Contig Information
Length 740 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 4
Wh_SHDr Shoot grown with dessication 4
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XB Root 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222640893|gb|EEE69025.1|| hypothetical protein OsJ_27997 [Oryza sativa Japonica Group]
Score 306
Evalue 1.00E-81
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5083
TTTTTTTTTTCTTTTTTTTTCCACTATAATAATTAATATAATGTGCAGCAGTACTATACACACACATCTATCAATCATCATCATCATACAAAAAGAAACA
CAGAGACGAAGGCCACTAAGGCCCGACCCTAACCTACATAGCATCTGCCAATCCATGCTCACACACACGCAGCTCAAACACAACCCATAGATTCTGGCCA
CCGAGAAAGAATCACATCACATCACATGGGCAGATGGCCGTTGTTGTTGGAGGCGCCGCCGTTGTAGGCCTTGTCCTCCGTCTTCCTCCTCTTGAGCACG
ATGGCCCAGGTGATCACCTCCAGCGCCACGGAGACGCCGCCCAGGATGGCGATGGCGATGATGTACCCCGTCTTCCACTTCTGCGCCACGTCCAGGATGC
TCATGCCCTTGAAGATGTTGACGATGCCCAGGATGATGATGGTGTAGCCCACCGAGTGGTGGTACACGTTCCAGTACACGCGCAGCTTGTGATCCTTCTT
GGGCCTCAGGAACAGCGCAAAGATCTGAACGGTGCCAAGAGCAAATACAGCGATCCCGATGTTCCTGTGAAGCGAGTAGGTGATTCCCTTGGACAGATTT
CCTAGATGAATACCGGTGGCCCAGCCAGACACTCCCACAGCATACCCGATCAGCTGGCAAGCAACGTGAAGGTAGAACCAGGCAGGGTCGGCTGATTTGA
ATGTCTTGAGGTATCTAGCAACTATGGCTCCCATTGGGAG
page-top