Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13670  (registered. 2002)
Contig Information
Length 494 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 7
Wh_dL Crown of seedling 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Cynodon dactylon]
Score 114
Evalue 0.000186579
Total Hit Count 7
Registered year 2002
Contig Sequence     [ Download ]
>Contig13670
ttttttttttgAAGAAGCATTTTCGTCCATTTAAGCTTGATATACTAGTAAATCAAACTGTAAAGATCGTCGGCAGAACCACTGACGATGACAACGACGA
CCACGACCACTACTACCGTTGAAACAGCAGCAGAGACACATGTAACCCCGTACTACATGTGTACGTTATTCAAACCTTCAACAGAGAGAAGCAAAGGTGC
GAGCTTGCAGCGCATGTCTTGCCGCCGCCCGCGCGCGCCCTACGGCGGGCAACACATGCCGCAACACGCCCAGCCATATATGGGGCAAGTGCGGCAGTTG
CAGTTTCTGTAGCCGCACCACAGGAGCCGGCGTGCCCCGCCGCCCGCCGCCGCTATCTGCGTGGCCATCAGCAGGACCACGAGGAGCATCACGCAGGAGA
CGAACATCTTGTTCCTCAGAAGTGCTGCCATGCCGCCGCCGGAGGCCATCGCTTCAGCTGGGTGGTGAGAGTGAGACGAAGTGCTCGgcgttac
page-top