Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13624  (registered. 2002)
Contig Information
Length 1105 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 1
Wh_oh Pistil at heading date 1
Wh_r Root 2
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100192989 [Zea mays] >gi|194690528|gb|ACF79348.1| unknown [Zea mays] >gi|194692096|gb|ACF80132.1| unknown [Zea mays] >gi|194700986|gb|ACF84577.1| unknown [Zea mays] >gi|194703832|gb|ACF86000.1| unknown [Zea mays] >gi|195628548|gb|ACG36104.1| ras-related protein ARA-3 [Zea mays]
Score 801
Evalue 2.22718e-83
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig13624
gaattagaaggctacaaaaagtgagcgagaccaactacctgtatacatgcaagaacagcacaagagctcacaccacagcatcacaacaagttattccatg
catatcgattgctcggaaagaaacagcagcaagccaACAGCATGGATTTGAAATCATTACACACTGTAGCGAGAGGTTCAACGGACTGAAATCCAGCGTA
CAATAGCTCCCAGCAATGGCAACAGCTACGTCAACGGCAAGGGTAGTTGCTTCAAAGAATGGGAAGCGAATATAAGTACAACCAGATCTGTATCATAAGT
CATAATTTTCTTCTTGATTGACATTCTTCCTATAACAGACAAGCAGCAGCAGGAACCGAATGATGTCAAATAAACAATGATCACGGACACACTGACTCGT
CCCTTAAGAGCCACAGCAGGCAGACCCCGAAGCTGCCGGGGCGTCGCCGCCTTCTGCCTTGTTAATCTTGATTGTCTTGTCCTCAGGCTTGGAATCGGTC
TCGGCAAGCCTCTGCTTAATGTCGCGGGCAATGGAGAAGAAAACTTGCTCCACGTTGAGGTTTGTCTTGGCACTAGTTTCAAAGAACTTGATGCCGTATT
CATCAGCCAAAGCTTGCCCCTTCGCAGTAGGTACAGCCCTTTTACTCTCATCCATATCAGCCTTGTTGCCAATCAAAATTTTGTTGACATTGTCAGAGGC
ATGCTGCTCGATGTTCCGGATCCAGTTCCTTATGTTGTTGAAAGATGACTCATCGGTGACGTCATAAACAAGCAGGATACCCATGGCTCCACGGTAATAC
GCAGTGGTAATAGTCCGGAAACGTTCTTGACCAGCCGTGTCCCATATTTGTAGCTTAATACGTTTCTGATCCAGCTCTATTGTTCTGATCTTAAAGTCAA
TACCGATCGTGGTAATAAAGCTCGTAGTGAAGGAGCCATCAGAGAACCGCagaagGAGGCAACTCTTGCCAACACCGCTGTCCCCGATGAGGAGGAGCTT
GATGAGGTAGTCGTAGTCGGCCCGGGCCCTCGCCGGCGGCGCAGCCATGTCGCGCGCACCCGCCTCCTCCtcctcCTCCTCCTCCTCCTCctcctcccct
cgtgc
page-top