Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13623  (registered. 2002)
Contig Information
Length 684 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 1
Wh_yf Spikelet at early flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0444600 [Oryza sativa (japonica cultivar-group)] >gi|38344536|emb|CAE02442.2| OSJNBa0027P08.4 [Oryza sativa (japonica cultivar-group)] >gi|38344584|emb|CAE02431.2| OSJNBa0058G03.7 [Oryza sativa (japonica cultivar-group)] >gi|113564465|dbj|BAF14808.1| Os04g0444600 [Oryza sativa (japonica cultivar-group)] >gi|125590511|gb|EAZ30861.1| hypothetical protein OsJ_014344 [Oryza sativa (japonica cultivar-group)] >gi|215694007|dbj|BAG89206.1| unnamed protein product [Oryza sativa Japonica Group]
Score 619
Evalue 1.23009e-62
Total Hit Count 176
Registered year 2002
Contig Sequence     [ Download ]
>Contig13623
ttcggcacgaggccgcttctTCTCCAGTCCGTTCCTTCTACCCATTGGGCCGGCCGCCATTGAGAGTTTGCTTCCTCCGCTCCGTGTCATCTCTGCAGGA
AATCCGCCATCGCTCGCCCGGGTGTACTGACCATGTCTGCCATGCAATCATCGTATCTTCCTGCTACCACTGAGTCAATTGCAATGGCTCAGGAAGCTAA
GGATGCTTCAGAGTCCATTTTAATCCTCTACCGTGTGCTTGAAGACCCGTCTTCTTCTTCAGATGCAGTTAGAACAAAAGAAGTTGCCATTACAAATCTG
ACAAACTATCTCACAAAAGAGAACAGAGCCGAGGAGCTTAGGAATCTGTTGACCCAGCTCAGGCCATTTTTCGCACTGATTCCCAAGGCAAAGACCGCAA
AGATTGTACGTGGCATCATTGATGCCGTTTCCAAGATACCTGGAACATCTGATCTTCAGATCTCACTCTGCAAGGAGATGGTGGAATGGACACGGGCAGA
GAAACGTACCTTCCTCAGGCAGCGTGTGGAAGCAAGACTAGCAGCCCTTCTTTTGGAAAGTCAGGAGTACACTGAAGCTCTTACCCTTCTTCCTGGTCTT
ATCAAGGAAGTGAGGAGGCTGGATGACAAATTGCTTCTTGTTGACATTGACCTTCTGGAGAGCAAACTCCATTTCTCTCTAagg
page-top