Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13606  (registered. 2002)
Contig Information
Length 1261 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 1
Wh_r Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_09533 [Oryza sativa Indica Group]
Score 1285
Evalue 2.01985e-139
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig13606
gcAGATATGCAACAGGCCCGACgttgtCGAAGTTTGGgatgcGACTgcgtcagatccgaagTTACTTGTCTATCTGAAGTCTTACAGGAACACAGTACCT
GTCCCAAGGCACTGGtcccaAAAGAGGAAATTCTTGCagggcaagAGAGGTATCGAAAAACAACCTTTCCAACTTCCTGACTTCATTGCTGCAACTGGAA
TAGAAAAAataagACAGGCATATATCGAGAAAGAGGATAGCAAAAAGTTGAAGCAGAAGCAGCGGGAGCGTATGCAGCCAAAAATGGGCAAGATGGATAT
AGATTATCAGGTTTTACACGACGCCTTCTTCAAATATCAAACAAAACCAAAATTGACTAGTCATGGTGACCTTTACtacgaagggaaagAGTTTGAGGTC
AAActtagGGAAATGAAGCCAGGTATGCTGTCCCGAGAACTTAAAGAAGCTCTTGGTATGCCAGAAGGTGCACCGCCTCCATGGCTTATAAACATGCAGA
GATATGGTCCTCCGCCCTCTTATCCTTCACTGAAGATTCCTGGTCTGAATGCCCCAATTCCTCCTGGTGCTACTTTTGGTTACCGGCCCGGGGAATGGGG
AAAGCCTCCTGTGGATGAGCATGGACGCCCCCTCTACGGAGATGTTTTTGGTATCCTACAGCTGGATGAACCTAATTATGATGAGGAGCCTGTTGACCGc
agcaAGCATTGGGGAGACTTGGAGGAGGAAGAGGAGGAGGAGGAAGATGaTCAGGGGAAGAAGGAGGAGGAGGAGTTCAGCACGGGGCCGCTGTCCATTC
TCATGCTCAGCGTCAAGAACAACACCCAGGTGCTTATCAACTGCAGGAACAACAAGAAGTTGCTTGGTCGCGTGAGGGCATTTGATCGTCATTGCAACAT
GGTTCTTGAGAATGTCAGGGAGATGTGGACTGAGGTTCCAAAGACTGGTAAAGGCAAGAAGAAGGCTCTCCCGGTGAACAAGGACAGGTTCATAAGCAAG
ATGTTCCTCCGCGGGGATTCGGTCATCATCGTCCTCAGGAACCCGAAATGAGTTTGACGACTCGGCGTAAACCAGAAGAGTCTCTTTTCGCTATGCTGCT
GTTAGTTTGTATGCCGAATGCTCTGGATCAGGGAATGTGTAAGACAGTTATCAAGCAAGCATTGCCTGTACTGATTAATGGTTTGGTGCtgtggtCTGGA
TGTTACGAATTCACGTCTTTTGTAGTAtctaatCTAacaacgtgcactggtagcggctgtt
page-top