Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13572  (registered. 2002)
Contig Information
Length 1109 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_e Seed DPA10 2
Wh_h Spike at heading date 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0529300 [Oryza sativa (japonica cultivar-group)] >gi|52353400|gb|AAU43968.1| putative ER lumen protein retaining receptor [Oryza sativa (japonica cultivar-group)] >gi|113579672|dbj|BAF18035.1| Os05g0529300 [Oryza sativa (japonica cultivar-group)] >gi|215734935|dbj|BAG95657.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218197143|gb|EEC79570.1| hypothetical protein OsI_20721 [Oryza sativa Indica Group]
Score 1007
Evalue 2.88862e-107
Total Hit Count 316
Registered year 2002
Contig Sequence     [ Download ]
>Contig13572
gcggacacagagcacgccgcacctcccccctTCCCGTCCCTtccatCGCCACGCCTCGCGTCCCCTCCGCCATTCCCCCGCCGCATCTGGAGCGAGCTCC
CACCGAATAAACCCCCAAAACCTAGT*CGCCGCCGTCGCCGTCGCCGGCGCCGCCGCAGCAGCCATGAACGCCTTCCGGTTCCTCGGGGACATGACCCAC
CTCTTCTCGGTCATCGTCCTCCTCCTCAAGATCTACGCCAACAAGTCATGCTCAGGGGTGTCGAGGAAGACGCAGGAGCTGTACCTGGCGGTGTTCGTGG
CGCGGTACCTCGACCTCTTCACAGACTACATCTCGCTCTACAACTCCGTCATGAAGATCGTCTTCATCACCACCTCCGCCGCCATCGTCTGGTACATGCG
CCGCCACCCGCAGGTGCGCCGCACCTACGACCGGGACCAGGACACCTTCCGCCACGTCTTCCTCGTCGCCGCCGCCTTCGCGCTCGCCCTCATCTTCAAC
GAGCGCTTCACCCTCCGCGAGATATGCTGGGCATTTTCGATTTACCTGGAGGCAGTGGCGATTCTACCTCAGTTAGTTCTGCTCCAGAGAAGCAGAAATG
TGGATAACTTGACTGGACAATATGTT*CTGTTTCTCGGGGCCTACCGCGCATTCTACATTCTAAACTGGATCTACCGTTATTTCACAGAGGGTCACCAAA
GCAGATGGATCCCTTGGATTGCTGGTTTGGTCCAAACTGGTCTATACGCAGATTTCTTCTACTACTATTTCTTGAGTTGGAAGAACAACGTGAAGCTCGA
GCTGCCTGCCTGAGCATGCTTTGTCCATGCGACAAAAAGCACACATTGCATTGCATGGGCCAGAAGTGTTGTCCAGATTGAGTTGATGATATTGGCATGA
AGAGACTCGGTGGTCCTAGTGGATTATCTTGGCAAAAAGCTATATTACGTTTGAGATGCTAACAGTACACTAGTAGACTAGTTCCATTTTGTACCTGGGA
TGGAGAATCAGCGAAtcccaatTCATTTGGCCTGTCGTTTGCCCGCTCTGTTTCACCTGCTGTAAACAAACAAACGATGCGATCTCCagtggtnctTGCC
Cgcgctatg
page-top