Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13436  (registered. 2002)
Contig Information
Length 734 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 5
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 1
Wh_r Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein Bm1_17870 [Brugia malayi] >gi|158598170|gb|EDP36122.1| hypothetical protein Bm1_17870 [Brugia malayi]
Score 231
Evalue 1.38334e-17
Total Hit Count 16
Registered year 2002
Contig Sequence     [ Download ]
>Contig13436
atTCGGCACGAGGgtcntaTGCTTGTCTCAAAGATTAAGCCTGCATGTGCAAGTATGAACCAATTTGAACTGTGAAACTGCGAATGGCTCATTAAATCAG
TTATAGTTTGTTTGATGGTACGTGCTACTCGGATAACCGTAGTAATTCTAGAGCTAATACGTGCAACAAACCCCGACTTCTGGGAGGGGCGCATTTATTA
GATAAAAGGCTGACGCGGGCTCTGCTCGCTGATCCGATGATTCATGATAACTCGACGGATCGCACGGCCTTCGTGCCGGCGACGCATCATTCAAATTTCT
GCCCTATCAACTTTCGATGGTAGGATAGGGGCCTACCATGGTGGTGACGGGTGACGGAGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCT
ACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCTGACACGGGGAGGTAGTGACAATAAATAACAATACCGGGCGCATTAGTGTCTGGTAA
TTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCCATTGGAGGGCCGCACCCTCTACGGCTTCGGCGGCTAGGTTCCTGGGTTCCGTTGGTGGCAGC
AGCAGTGTGGTTGCGGCTGTGTCTGTCTTGTGCCCTCTGTGATGTGTGCTGTGGGAGATGGGATTTACTGCTGCTTTGGCGTGCGTCGTTGTGTTCCGTG
TCTTGTGTTCAGTAGgctgtaatatcttgttgcg
page-top