Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13433  (registered. 2002)
Contig Information
Length 643 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_dL Crown of seedling 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit small nuclear ribonucleoprotein E [Zea mays] >gi|195611048|gb|ACG27354.1| small nuclear ribonucleoprotein E [Zea mays]
Score 423
Evalue 5.72335e-40
Total Hit Count 489
Registered year 2002
Contig Sequence     [ Download ]
>Contig13433
gcACACGCGGTTCCGtccAGAAGCTTCTAG*ACACTTCCAGTCGGAGGAGGAGCTCACGCCGCAGCAGCAGCCATGGCGTCCACCAAAGTCCAGCGTATC
ATGACCCAGCCCATCAACCTCATCTTTCGGTTCCTCCAGAGCAAAGCGCGCATCCAGATCTGGCTTTTCGAGCAGAAGGATATGCGGATCGAGGGTCGTA
TCATCGGCTTTGATGAGTACATGAACCTGGTTCTCGAGGATGCTGAGGAAATCAACATTAAGAAGAACACCAGGAAATCGTTGGGAAGGATACTCTTGAA
AGGCGACAACATAACTCTGATGATGAACACTGGAAAGTGAAGCTTCTCTCTCTAGGATGGCTGGCGTTGTCGTTCCTATGTTGAGCGTTCCTGTGATACT
TTGTACTCCACCCAGGCTGATATGCATGTAGCTTGTCGTTGTGGTCATTTGAGGATATGTAACGTCTGTTGTCCATCTATGAACCCAGACCCAGTAAATC
CATTCTGTCTACTCCGTGCAAGATGTTTGATCAAGATGATGAGCTTATTGGTTGTGTTTAAGATTGACATGAACAGATCCTGTTGACTtgtttgttgaGC
TTATTAGTTACGACTGcatgttatgtttttttcaaaaaaaaaa
page-top