Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5055  (registered. 2012)
Contig Information
Length 1377 bp
Clones alternative view 32 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 3
Wh_CSEC Callus 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_OKCS Seed DPA5 1
Wh_RDr Root of dessiccated seed 3
Wh_SHC Shoot grown with cold treatment 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VHS Shoot with heat shock treatment 1
Wh_VSCB Liquid cultured tissue 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 3
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XA Root 2
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|117670154|gb|ABK56721.1|| unknown [Hordeum vulgare]
Score 486
Evalue 3.00E-135
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5055
TCATCTTCATCACATTTCACAGGAAACGAACAAGGCAGGCGCAACTCAGCGCCCTGCCAACAGCAAATCCTCTCCGGAGTTCAGGTCCACTGCAAAAACT
CCAAGCCTTTCTTCTCATCTCCGCCTCACTGCAGCTGTTCACGGAACACCCTCAGTATGTCGGCGAACGTGACGATCCCAGCGAGACGGCAGTCATCCTC
CTCGTCGAGAACCCACAGATAGCTCACGCGGTGGGCGAGGGCCTGCACCATGACGGCCACCAGCGAGCTCGCGGGGCTGCACACCACAGGCTCCTCGGTC
GACCGGCGCCCAAAGCTCCCCGACGACGGGCGCCTCAGGTGCGGCCGGCCGGTGTCGTCGTCTGACGACGAGGAAGAGAGGGAGAACGATGTCATCGTCT
CGTCCTCCATCAGCTCAAGGATGGCGTCAAGGCCCTTGGCCTTGAGCCCGGTCTTGATGGCACACAGGATGTGCTCCGGCGGCGAGCCGAAGTAGTCGAT
GTACCACACTCCCCACCTTCTTGCGCCACAAGCCGGAGCAGACGATCCGCCGTCGACGCGACCTCCTCCGCCCGCCGGGATCGGAGACGACTATATAGAC
GGTCTAGAGGTTGAAGCAACTTAACAATGAGTAGCATAGGAACTGGGTATGATCTGTCCGTCACCACTTTCTCCCCGGACGGACGTGTCTTCCAGGTCGA
GTATGCTGGCAAGGCCGTCGACAACAGCGGGACGATCGTTGGGATCAAATGCAAAGATGGAATTGTCCTTGGTGTGGAGAAGCTGATAACATCAAAGATG
ATACTTGCTGGGTCGAACCGGAGACTTCATTCCGTGCACCGAAACTCTGGCTTGGCTGTGGCTGGGTTAGCAGCAGACGGTAGGCAGATAGTCTCAAGAG
CAAAGTCAGAAGCAGCCAATTATGAAAAGGTATACGGAGAACCCATGCCTGTAAAGGAATTAGCTGATCGTGTTGCTAGCTATGTTCATCTGTGTACACT
CTACTGGTGGCTCAGGCCTTTTGGCTGTGGAGTTATTCTTGGAGGCTATGATAGGGATGGGCCACAGCTCTACATGATCGAACCTTCAGGCCTCTCCTAT
AAATATTTTGGTGCTGCTCTGGGTAAAGGAAGACAAGCTGCAAAAACGGAGATTGAGAAATTGAAGCTTTCTGAGCTAACCTGCAGGGAAGGCATCGTTG
AGGTTGCCAAGATAATTTATGGTGTACACGACGAAGCGAAAGACAAATCTTTTGAGCTGGAACTGAGCTGGGTATGTGAGGAATCTAACCGTCAGCACGA
GANNNTTCCGAGTGATCTTCTGGAGCAGGCCAAGGCAGCAGCTCANNCAGCGTTGGAAGAGATGGATGCTGACTGAG
page-top