Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5053  (registered. 2012)
Contig Information
Length 598 bp
Clones alternative view 37 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 4
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 8
WH_XN Leaves, plant was grown at constant 23℃ 4
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig5053
TTTTTTTTTTGAATACTCAATCACAGTAGACAGTACTTGTAAGTATATTCGTGGGTCTCGTACACACCGATTAATTACACACGACGAGGTGCATGAATAT
CGCACCCAACACGGATACATGAATCGATATCTCACACTGGTACTGATCATGCATGCATCAACTTAGGAGTATATACTGTATAGAACCTAAAACAACGGGC
ACTGAAATTAAGAACAATTCTCTCTCTGTATACGCATACGCTCCTCCTCCTCGTGGGTACTATAGCACCGAGGTCTTGTGCCAGCCAGCAGCGGCCTCGC
CGGCCGGCCGGTTAGTCGCAGCACATCTCGCAGATCCAGCAGCAGCACAGTGCGGCGAGGCATCCCTCGATGAAGCCCTTCTCGCCCCTGGATTTGGTGC
TCGCCCGGCGCCCCTTCTTCCCGCCGACCTGGTCCTGCTCCGCAGCCGCCGTCGGGTACCCTGGCGGTGGTGGAGGAGCCTGCTGGTTGCTCCTGTTGTT
CTCCATCAGGTATGTCCTCTGGCTACGAGTTGCTTCTGCTGTGCTGTGCTGTGCTATCGATCGGATCCTCGTGCCGAATTCGGCACGAGGCCTCGTGC
page-top