Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13376  (registered. 2002)
Contig Information
Length 2246 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_oh Pistil at heading date 3
Wh_yd Spikelet at late flowering 1
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_03826 [Oryza sativa Indica Group]
Score 2469
Evalue 0
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig13376
ggtaaatgcgcgcgcaggcgtgggcgcgcgggggggcggtggcgcgcttgatgacgccattcaattgccccacggcccacgcctcctcccccgacctgct
gctgccgcggctgctgctgctccgctcctcctcctcctgctcctcttatagcatcctccccactctcctccgacgccaattcgcctcggacacctccacc
tcccctgcctcagttgacaacaccagacagagttctcgtacgttcatggaggttgttcgagaagtctttaagcacggctctgcacatggtgcccgtgcgg
ctataagagctgaccagaagagttacagtcttgtccagcttatttcgtctgcactggatgtccacaatattttgTGCAGAAAACATGATGGTAAAGATTC
TTCTGTCAATGGAGcaaaagggaCAGGATTCCTTTGTGGTGCTCGTATTGGCattgtGGCTAAACCCTCTCCTGAATTTGTTGCTGGGATATTTGGAACC
TGGCTTTCTGGTGGAGTTGCAGTACCCCTTGCACTTAGCTATCCTGAAGTTGAActtctGCATGTCATGAATGACTCGGACATTTCTATGGTGTTAAGCA
CAAAAGAGCATCATgagatTATGGAAAGCATCTCTACcaaatgttccactcgttattctcttcttccaactgtggaaagtatacctccaaagatagatgc
ccaagaacctttaagtagtgtagtgacttcatcagtttctagcttaatggctgagattgacactttaaagaaaattaaaggagatgatcctgctcttatc
cTTTACACAAGTGGCACAACTGGTAAACCGAAAGGAGTAGTCCACACTCATGAGGGGATACTTTCTCAGGTTCAAATTCTGACAGAGGCATGGGGATATC
AAAGTGAAGATCAGTTTCTCCACTGTCTTCCACTGCACCATGTGCATGGTCTTTTCAATGCTCTATTTGCGCCTCTCTATTCAGGATCAGTGGTCGAATT
TTTGCCAAAATTCAGTGTGAGGGGAGTATGGCAGAGATGGCGCGAGTCATATCCCAACGACGGCAGTAAAAATGATGAGGCTATTACAGTATTTACTGGA
GTTCCGACAGTGTACACACGCCTACTGCAAGGGTACGATAGTATGAATCCTGATCAACAGTCTGCCTGTTCTTATGCCGCAAAGCAGCTGAGACTAATGA
TGTGTGGATCATCAGCACTTCCTTCCCCACTCATGAAACGGTGGCAGGAAGTGACAGGCCACCGTCTTTTGGAACGCTATGGCATGACTGAGTTTGTCAT
GGCACTGTCTAATCCATTGCATGGTGcaaggaAAGAAGGTACAGTCGGTAAACCTCTTCCGCGTGTTGAGGCCAAGATCATTATGGACGATGGTACTGAA
ACTAAAACTGGAGTCGGTGAGCTCTGTATTAAAAGTCCGTCCCTTTTCAAAGAGTACTGGAAAAGACCGGAGGTTACAGCAGAATCATTTATTGATGGTG
GGTTCTTCAAGACTGGTGATACGGTAACCGTAGATGAGGACGGATACTTTATAATTCTAGGGCGCACAAATGCTGATATCATGAAAGTTGGTGGTTATAA
GTTGTCAGCGTTAGAAATTGAGGCGGTTCTGTTAGAGCATGACACTGTACTGGAGTGTGCTGTTCTTGGCTTGCCCGATGAAGCTTATGGGGAGGCTATA
TGTGCAATAATTGTGCCTAAGGAGGATGCAAAGGAAAAGGCTGAACAGGCTTCAAAGCCAGCACTAACCTTAGAAGCATTGACAAGTTGGTCAAAAGATA
AACTTGCTCCATACAAGATTCCAACAAGATTGCACTTATGGGATTCTCTTCCTCGGAATGCCATGGGAAAGGTTAACAAGAAGGAGCTTAAGAAATTATT
AGAGGTGTAGCTGTAGAAGTGCACGCTCTAGCCAATGCAACCAAAAGACCGATCTGATGGAAGAGACTAGGCAGCACATTATACGTCAACACTCCCCTTC
ACGTGTGGCTCCTTCAGGCCTAAACGTGGATCGAAAGTGGGCTGCAATTTAATTGCGCCAGCTGGGTCTTGAACTCAAGACCTCTTGGCTCTGATATCAT
GTAAAAGTGCATGCTCT*AGCCAGTGCAATCAAAAAACCGATTTGATGGAAGAGACTAGGCAGCACATTATACGTCAACAgtagccacatttacattgat
gtacctatttttccatctcacccttctacgagggagacatatagca
page-top