Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13341  (registered. 2002)
Contig Information
Length 561 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_yd Spikelet at late flowering 4
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit histone H4 [Zea mays]
Score 389
Evalue 3.51257e-36
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig13341
gcacCACCGCTCCTCCT*CCGTTTCCATCTCAGTCAGCTCCAAGCCGTCAACCATGTCCGGCCGCGGCAAGGGAGGGAAGGGCCTCGGCAAGGGCGGCGC
CAAGCGCCACCGGAAGGTGCTCCGGGACAACATCCAGGGCATCACCAAGCCGGCCATCCGGCGGCTGGCTCGCCGTGGAGGCGTGAAGCGCATCTCGGGG
CTCATCTACGAGGAGACCCGCGGCGTGCTCAAGATCTTCCTGGAGAACGTCATCCGCGACGCCGTCACCTACACCGAGCACGCCCGCCGCAAGACCGTCA
CCGCCATGGACGTCGTCTACGCCCTCAAGCGACAGGGGCGAACCCTCTACGGATTCGGCGGCTGACCTGCGCCCGCTGCTCCAATCTCCATCTGCTATGG
TTTCTCTGCTATGGTTTTGTTTCTGAGTGCGTGCGTGCGTTGCTGTTCCATCGGCCTGTGTAGTTAGTGGATGGCGATGGATCTGAATGTAATGGACTTG
TTGGTTCTTGCAAGAAATGAATCTGAATTCAATGGAAGTTGTACCgcatctaaaaaaaaaa
page-top