Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13334  (registered. 2002)
Contig Information
Length 1365 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_oh Pistil at heading date 3
Wh_r Root 1
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_32390 [Oryza sativa Indica Group]
Score 1195
Evalue 6.17807e-129
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig13334
cgaggcccaatcgaccgagaacccgcgtgctctcgccgcctcctcctccctccccccgcggcgtcgccgaacgaAACCCTAGCTCGGTCGCGCCCGCCCG
CGCCGTCGTCTCGCCGgagagCGGAGAGGGCGGAGAGGGAGAGGGAGAGGGAGCGGGAGGCGGGGATGGGGAAGAAGAAGAAGCGGGTGGAGAAGGTGTT
CTGCTACTACTGCGACCGGGAGTTCGACGACGAGAAGATCCTGGTGCAGCACCAGAAGGCCAAGCACTTCAAGTGCCACGTCTGCCACAAGAAGCTCTCG
ACCGCCGGCGGCATGGCCATCCACGTCCTCCAGGTCCACAAGGAGTCCGTCACCAAGGTTCCGAATGCCAAGCCCGAGAGGGATTCCACCGAGATCGAGA
TCTTCGGCATGCAGGGGATCCCCTCCGACGTGCTCGCCGCCCACTATGGGGAAGAGGAAGATCCTTCATCAAAGGTGGCCAAAGTAGAAGTGCCGACAAT
AAGACCTCCTATTATGCCTAATTATCCGCTAGGCATGCCTTTTCCTCCTCGGCCTTATGGTGCAGCCCGCCCTATGTATAATCCTGCAATGATGGTCCGA
CCTCCGATTTGGCCTCTTCAGCAGCCGCAACCTTGGTTTGCTCAACAACCACCGGTTTCAGTTCCCCCAATGATTGCTGGGCAAGCACCACAGCAACCAC
TATTTCCCATTCAAAACATGCCCAATCCTATGATGACATCAGCACCTGCTAATTT*ACTTCAGACATCATATGCTATGGCCACCACAGGGGTTCCTTCAC
CTGTTGCCCCTCAGGCTTCCCAGCCTTTGTTTCCTGTTAACACCACTGGCAATGGAGCCGCAAATTCCTCATTCAGCTCGTCAATTTCACCTGCAACTAT
TGCAGCAAATTCTCCAGCATCAGTTGGTACGGCAGGATATGGCTATGTAGCTAATAACCATGGTACAGGAGGACCAGCAGTTGGACATCCACCTGCACCT
ACCACTAATAGTAAAACGTCTGCTACTCAACCAGCTACAAGTGAGGTCTATCTGGTGTGGGATGATGAAGCAATGTCAATGGAGGAAAGAAGGTTGGCGC
TGCCCATGTACCAGGTGCATGACGAAACTAGCCAGATGAGCTCGGTTGATGCAGCGTTCGATCGAAGAATATCAGATATTACATTTTCTAGACAATCCAC
ATAAACAAGCTGCGCCCGGTGTTCAGTAAACAGCTTGATGCGATTCACCAACGGGCTCACCCGTGCATCCGTAGGAGGGACGCCGTGCAATCGGTGATCC
TGGATCCCCCCTGTTGTTGATCTACTTAGTTagtgaCTGGAGCTACTGCAgttgaaagattgtat
page-top