Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13314  (registered. 2002)
Contig Information
Length 973 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_e Seed DPA10 1
Wh_yd Spikelet at late flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os12g0563600 [Oryza sativa (japonica cultivar-group)] >gi|77556167|gb|ABA98963.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|113649545|dbj|BAF30057.1| Os12g0563600 [Oryza sativa (japonica cultivar-group)]
Score 629
Evalue 1.60454e-63
Total Hit Count 187
Registered year 2002
Contig Sequence     [ Download ]
>Contig13314
gaggaattcggcacgagggacccactagctccagctgcagcaagcaagccaacttgtgcgtgtgagtgagtgagcgagagctcagggaAACCACCCTACA
AAGCTCCGGCTGAGCCacccaacCGGCCGGCGACGATGCCGATGCTCATCCCCGACGACgtgcgCGCCAAGGCGGAGATCTACACCGGCGACgcagcGGG
GCAGGAGAAGACGCGGCTGATGCTGGCGGAGACGGAGCTCCCCAGCGGCCTCCTGCCGCTCAAGGACATCATCGAGTGCGGGTACGTGGAGGAGACTGGC
TTCGTGTGGCTCAAGCAGAAGAAGCGGGTGGACCACTACTTCGCCAAGGCCGGCCGCCATGTCTCCTACGCCACCGAGGTCTCCGCCATCGCCGAGAAGG
GCCGCCTGAAGAAGATCTCCGGCGTCAAGGCCAAGGAGATGCTCATCTGGGTCAACCTCCACGAGATCTGCGTCGACGACCCGCCCACCGGCAAGCTCCA
CTGCAAGGCCATCGGCGGCCTCTCCCGCAGCTTCCCCGTGGAGGCATTCGAGGCCACCGACGCCCTGCCCGTGCCCGTCACCGGACGTCTCAAGAAGAAG
ACAGAGAAGGAGAGCGCCGACCAGAAAGACGAGAAGAAGAAGGAGGAGGAGGCAGAGAAGCCCAAGGGGGCC*GCCGTCGCCCCCGCCCCCGCCGCCGTC
GACGAGATCGGTCAGAAAATGAAGGAGATGAACACGGAGGCACCGGTGCAGGCGGAGGCGGTAGCAGCCAAGAACTGAACGGCGACGGCGGCACGTCATG
ATCGGTTACCCAGTCATAAATTTGTGTCAGAATAACGCATTGCATTAGCATGTCATCAACCATCCACACATATGTATCACCTGATCCATCGATGAGAGTT
CAGTTCGACAACGATGTAATTTGCCTTTTtctggtTTTAATgtgatgAAATTtaatggatgtcaaaaaaaaaa
page-top