Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13312  (registered. 2002)
Contig Information
Length 717 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 3
Wh_r Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0504500 [Oryza sativa (japonica cultivar-group)] >gi|48716187|dbj|BAD23227.1| ubiquitin-associated (UBA)/TS-N domain-containing protein-like [Oryza sativa Japonica Group] >gi|113536443|dbj|BAF08826.1| Os02g0504500 [Oryza sativa (japonica cultivar-group)] >gi|125582227|gb|EAZ23158.1| hypothetical protein OsJ_006641 [Oryza sativa (japonica cultivar-group)] >gi|215736872|dbj|BAG95801.1| unnamed protein product [Oryza sativa Japonica Group]
Score 767
Evalue 1.29458e-81
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig13312
accctaaacctcctcgcaaaaaggaagcagctttcgagtttcgcccccaaattcgctcgatcggaagcgacccCGTAGAGAGCAGCAATGGCGGGGCTGT
CCCTGCGGTGCGGCGACTGCGggcGTGCAGCTGAGGAGCGTGGAGGAGGCGCAGGCGCACGCCGAGGCCACCTCCCACACCAACTTCGCCGAGTCCACCG
AGGCCGTCCTCAACCTCGTCTGCGCCGACTGCGGCAAGCCATGCCGCTCCCAGACCGAGGTGGACCTGCACAAGAAGCGCACGGGCCACGCCGAGTTCAC
GGACAAGACCATGGAGGCGGCCAAGCCCATCGATCTCGAGGCGCCGCCGAAGCCGGCCTCGGAGGCCATGGATGTGGACGCGTCGGGGAGTGCGGAGCCG
CAAGAGTTGGTGTCCCCAGAGGTGAACAAGGAGATGCTTGGGGAACTCGAATCGATGGGCTTTTCGACTGCGCGTGCCACTAGGGCACTTCACTTCTCCG
GTAATAGCACCATTGAAGGCGCCATTAATTGGCTCTCTGAGCATCAGGAGGATCCGGATATTGATGAAATGCCTATGGTGCCGGCCAACACCGTGGCTAA
CAAGCCCTCTCTAACCGAGGAAGAGAAGAAGATTAAGGCACAGGAGCTGAGGGAGCGTGCTCGtaaaaagaatgaagaagaagaaaaaaggatggagaga
gaaagggaaaaggagcg
page-top