Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13249  (registered. 2002)
Contig Information
Length 753 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_dL Crown of seedling 2
Wh_r Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195619630|gb|ACG31645.1| polyubiquitin 2 [Zea mays] >gi|195620202|gb|ACG31931.1| polyubiquitin 2 [Zea mays] >gi|195620238|gb|ACG31949.1| polyubiquitin 2 [Zea mays] >gi|195620732|gb|ACG32196.1| polyubiquitin 2 [Zea mays] >gi|195620942|gb|ACG32301.1| polyubiquitin 2 [Zea mays] >gi|195628320|gb|ACG35990.1| polyubiquitin 2 [Zea mays]
Score 677
Evalue 2.7608e-69
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig13249
ttttttttttcAGGTGATATATGGAT*CTTACTACGCAGCAGAGCTAATAACAGAGGCGGATAAAGTTGCGACTAGTTTTGTCAAATCATATAGGCAGAT
AACATGGAAGACAGCCCCTCCCACTAAGCAAAGCTAGTTTGTTATTATCTCTTTGCAACACCAACACAGGTTCCATGCCACCAATGGTCACTTCTCTCAG
GAGGCAAGTGTTTCCATTACAGCTTAACTAGTAACCACCCCTCAGAGCAAGGACAAGATGGAGGACCGAGCCACCTTCGATGTTGTAGTCCTTGGCAGTC
TTGTCATCTGCAAGCTGCTTACCAGCGTAAATCAGCCTTTGCTGCACAGGAGGAATGCCTTCTTTCTCCTCAACGCGCTCCTTGATCCTGTCAATCGTGT
CGGTGGGCTCAATGTCGATTTCGATCTCCTTCCCAGTGAGAGTCTTGACCTTGATCATCGTGCCGCCCCTGAGCCTGAGGACCAAGTGAAGAGTCGACTC
CTTCTGAATGTTGTAGTCAGCAAGCGTGCGTCCATCCTCCAACTGCTTGCCAGCAAATATCAAACGCTGCTGGTCCGGAGGAATCCCTTCCTTGTCCTGG
ATTTTGGCCTTGACGTTGTCGACGGTGTCGCTGCTCTCGACCTCGAGGGTGATGGTCTTCCCCGTGAGGGT*CTTGACGAAGATCTGCATCTTCCTGCTG
CTCGTGCGTGCGGTGCGGGAGGGAGTCAAGCTgctggtCGCGTGAGGACGacc
page-top