Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13199  (registered. 2002)
Contig Information
Length 1083 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 5
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit serine/threonine kinase [Triticum aestivum]
Score 974
Evalue 1.86242e-103
Total Hit Count 415
Registered year 2002
Contig Sequence     [ Download ]
>Contig13199
ttttttttttacactaacgtgttctattaaatCTCGCAAACTGTACAAGCGAAgccaaattaTCCTCTTCATTGGAGGGTTTGTCGACTGTTAGATTGCA
CATGAACAGGACAACGGTCTGCGATATGAACGATTGAGAAAACTAGTTCACAAACCAAACCAAGACCACACATGTTTTGTTCATACACGGG*ACAAACTC
GGGGCATGGGCAAATCCACACCCCAGTACAGGGAAAGGTCAGCAGGCTCGAGCACATTCACAACACATTCTCTACCGTGGCACCTGAACCAAGCAAGCAG
GGGGAGGAAACTACCGCAAGGACCATGAACAGGCAAAACACACGGTTGGCGCCGAGGCGAACCTGGTTTTCGCTCTGTAGCCTACATGCCTCGCTGCTGC
AGCTGATCGGTTCTTCACTCTATACTCCTTTAGCTCACCAACTTTCTTGTCAATCTCTTTGCCGGAGGGATTTCGTCGGATTTCCCGAGGAAGTCTGACT
TGAGATGCCCAGCCTTCAACAGCGGGACAGGGGGCTTCACGGCCGTGCGTGTTCGAGAGGTCACAGACATATGAGCAAGCTTTTCGGTGATAGTCGAAAC
CTTCTGAACCGTTGCCCGGCCAGTTTCAGGTAAACTGCGTGAATGCCTTAATATCGGGTTCGCGTTCCCTGGGCTATTCCTTGCCGGTACTCGACTAGTA
GTTTGTTTGGTGTTACTCTCAGTGGGCCGTGCACTCTTCTGTGGTGCCTGGCGATCCAATT*GAAGTTTTCTTTGCACACCGATCTTAGATAAGCTGCTC
GGTTTTATAGATATGTTGgcAGCAGGTTTGCTTGTGGAGAGAGCTCCAGTGGAGTATCTCCGAGCAATGTGTCCTgaaagtcCTCTTGCTCCAACACCCG
GAGGAGTTTTaggagggcctGCAGCTTTTGGCCGGACagaagCTGGAACATATGTACAATCCTTAAAGAAGGCATGTTGGAGAacttccgcggcttttgg
tctcttgcaaggatcccatgagcacagagaggatataaggtcaactgcctcactactggctgatttcattacctccgacagtt
page-top