Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13181  (registered. 2002)
Contig Information
Length 738 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_dL Crown of seedling 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit B0812A04.3 [Oryza sativa (indica cultivar-group)] >gi|125548607|gb|EAY94429.1| hypothetical protein OsI_16199 [Oryza sativa Indica Group] >gi|125590644|gb|EAZ30994.1| hypothetical protein OsJ_014477 [Oryza sativa (japonica cultivar-group)]
Score 747
Evalue 2.04708e-77
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig13181
gccgccccgacgtcgtcaacctgccgaccatcttcacctccctcggcctcgagtacgacgacaaggtgctcccctccatcgggaacgaggtgctcaaggc
cgtcgtcgcccagttcaacgccgaccagctcctcaccgaccgcccccatgtgTCGGCGCTCGTCCGCGACTCCCTCATCAAAAGGGCCCGCGAGTTCAAC
ATCATACTCGACGACGTCGCCATCACCCACCTCTCCTACGGCGCCGATTTCTCCCAGGCCGTCGAGAAGAAGCAGGTCGCGCAGCAGGAGGCTGAGCGCT
CCAAGTTCCTGGTCGCCAAGGCCGAGCAGGAGAGGCGCGCTGCCATCGTGCGTGCTGAGGGAGAAAGCGAGTCTGCACGGCTCATTTCTGAGGCCACCGC
CATCGCTGGGACAGGGCTGATCGAGCTGAGGAGGATCGAGGCTGCCAAGGAGATCGCCGCGGAGCTGGCCTGCTCACCCAACGTTGCCTACATCCCCTCT
GGTGACAACGGCAAGATGCTGCTCGGCCTCAACGCTGCTGGATTCGGCGGCCGGTGATTTACCACTCCTGTTTTACTTGCCCAAACATCATCTTGCGTCA
TGACGGACTAAACTATGGTTTGGAGAGACAATGATATCTGTTGCTGTAGGATCTTATTAAGTTTGAATGTCTTGGGACAAAATCTGGTAGTCTTTTGATC
CAAATAAGGTCTGGATCTGGAtatcttgcttatgattt
page-top