Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12984  (registered. 2002)
Contig Information
Length 813 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 2
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0441900 [Oryza sativa (japonica cultivar-group)] >gi|113564449|dbj|BAF14792.1| Os04g0441900 [Oryza sativa (japonica cultivar-group)]
Score 654
Evalue 1.48192e-66
Total Hit Count 208
Registered year 2002
Contig Sequence     [ Download ]
>Contig12984
ttttttttttgccctgtacaagacaccaaatctgaataatGCCGACCGCATTACGGCCAAAATGCATGTCACTGGTGTGAATGGTTTTTTTTTCCAGCAG
GCAAAACTTATACATCAACAAGAATCCTGAAGATCCATCTAGAAATTGCTGTCGCTAAGCATAAAAAAACAAACCAAAATCAAATAAACGGTAATGGCAA
CAAGACTATGTGTATTGTGTCCACGCGCCCAATCTGAACCTGTTACATATCCTTCTCTTAATGGTCA*GCAACGCGTGAAGATGAGTTCatcAGCGTCGA
ATTTGGCACACAGAAAATTTGTGCCCGGCGGCCAAAACGGCCAGTGCTGCCGAGATGTGTCTGTGTCGATTGAAGCTTGCGGAGGCTCACTTTGTCTTCT
TGTCCTCCGTGCTCGTCTCAGCCTTGGCCTCGATCTGTTGGGCAGCCGCTGCTCCTTCCAAAGTTTGGGGCGCTGCGGGTTCGTCTTCCCCTCCAAAGCC
AAACTCGT*TGACACGCTTCTTGTCAACTGGGTATACCCACCTCTGGTAGAGGTATATCAAGAAGATAACATCATCTCTGAAAACCGAGAGACGATGCAA
CcatggcATCTTAATCACAAATGCAAACAGATCATCAATTATAGTGTTGAGGAACTTGTAGGTCATTTGTCTCCATGGCATGTGAGCAACGGACTTCAGC
TTGTAGTTGATAAATAATTGTGGGCACATCATAATGAAACCAAACATGTAAACACAACTTGTGAGGGAAGAGAGTATCCACGAGTACCAGCTCTtgtgtT
TATCATACTTGag
page-top