Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12968  (registered. 2002)
Contig Information
Length 610 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 2
Wh_r Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0124900 [Oryza sativa (japonica cultivar-group)] >gi|113594686|dbj|BAF18560.1| Os06g0124900 [Oryza sativa (japonica cultivar-group)]
Score 206
Evalue 7.27887e-15
Total Hit Count 28
Registered year 2002
Contig Sequence     [ Download ]
>Contig12968
actctggtggaggctcgaagcgatactgacgtgcaaatcgttcgtctgacttgggtataggggcgaaagactaatcgaaccatctagtagctggttccct
ccgaagtttccctcaggatagcATCGACAGG*CGCTCGCTCGCGAGGATGATCTACCGCAACTGGTCCCTGCTCTCCTCCACGGTCGTCATCTGGGGCAG
CGTCGGCGCCGCCGGCCTCGCCGGGATCTTCCTCTTCGGCGGCAAGGAGAAATTCCAGGGCTATCTTTCTCGCGAAGGCGAGAGGCTAAGGCAGCAGGAC
AGAGCCATGATGGGCAAGAACTAGTGCAGAGCACGGCTCACTTTCGACGTGTCAACATGTGAACTAGACATGAAACGACGTATCTCTGTGGTTTAGAACA
AAACTTTCTCTTCCTGCCAATGGCACCTTTTGCTTCTGGCCCCCATGAATAATCTTGACGCGGATGTTCATTCTGTTCCCCCGTGAATATTCTCGACGCC
GATGTTTGCTCTGTCCCCTTTGGTAGCCTGCTGTTTGTCGACTTTGTT*CTGGCGCTCTGAATAAGTTTTGATACTGATATACCATTGCTGTTGAGTCGc
aaaaaaaaaa
page-top