Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12821  (registered. 2002)
Contig Information
Length 807 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_dL Crown of seedling 2
Wh_oh Pistil at heading date 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glutamine-dependent asparagine synthetase [Triticum aestivum]
Score 1132
Evalue 5.45972e-122
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig12821
tgtaataatgttttgatggaagttgcc*gaaaggattacaaatcgTCATAAGAACAATAGAAACATTAATGCACAATCTTCACTCAAACCTTAGGTCTGC
ACCACTCTAATGGCAAGACCAGGTACATCTTATTTCTTATCAGAAACGGCAAGCAGGACAGGACACCATCAACTCTCAATTGCGACACCAGGCGCCGCAA
CCTCGATCATCCTCGGCTTCTTGCTGGTTCCTGCCATGATGGTTGCTGGGAGATGCTCCTGTTCATAGGCCGAGAGATGGACTCCAAGTGCTGCTCTCCC
TGAGGGATCCAGGTTCCCTGACCACTGGGCATCCCACTCTATCGCCTTCGCCGTGCTGCATGCAACGCTTGGCCCACCTGGCACCGTCAGGATCGCCGAG
TTCTGGGGGAAGAACCTCTCAAATATCATCCTGTAACAGTAGGCCTCTTTTGTAGTTGGGGTGTTGTGTGGGTAGATGAACTTTGCATTTGACATCATCT
TATCTGTCACATTCGATTCTGCGTGAGCCTTTAGGCCATCAATCCAGCTGTAGCCAACACCATCACTGAACTGCTCTTTCTGCCTGTACAGAATATGCTT
CGGCAGGAATGGTTGCTCCTCGTCATCAAATGCTTTCCTCAGCACCCATTTCTCAATTCTTCCAAGATCAGGCCGGATCATCTTCCACTCAGGATCAATG
CTCATTGCCTCATTGATAAACTCCTTGTCCAAGAATGGCACACGTGCTTcgaggccccatgcagatgttgccttgttggccctcaagcaatcgtactgat
gcagagc
page-top