Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12816  (registered. 2002)
Contig Information
Length 708 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 3
Wh_yd Spikelet at late flowering 1
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ubiquitin ligase SINAT5 [Zea mays] >gi|219887251|gb|ACL54000.1| unknown [Zea mays]
Score 629
Evalue 8.91147e-64
Total Hit Count 236
Registered year 2002
Contig Sequence     [ Download ]
>Contig12816
aaagttcagaACATTTGCGGTCTGACATAGATACGAGTCTCATCTCATACTAG*AG*AGGGGCTACATCATTTACAGTCCACGAGGCACCAGCAACATCT
CACCAAACGGCAGCGCAGCGGCCAGCCAGCCAGCTCTTGTTCAAAGCAAAACAGGAGATTTGCCTTGAGCTCTACCAGTACCACATCAGTACCACCTCGG
TTCTCATCACAACCATCCATGGAAACATCTCACAACTACTAGAACCTAAGAGACATTCTACACACCATTACCTAGTCCTAATCAAGCCCTCACAGCGGTT
CACTCGG*AAACAACCTTCTAAGCATGCAGCTACAGCTCACTGTTCCTTCCAAATTCGCCCGGTGACCCGCAGCTTGAGCTCCTTCCTGTCGCCCCCGGA
GAAGCACAGGGCCATGTTGCGCTGGATGATGAGCCCGTCGTAGCTGTCCCGGACTTTCCTGTGGCTATCCCTGATGCTCCGAGGGATGCCCTGCCAGGTC
ATCTTACGGTTGATGCCTCCGACCTCCAGGCTGTAGGTGTAGTTCTTGGCCTCGGCGTCGTCTCCCATGAACCTCAGGAAGGCGATGTAGACCGGCGCCA
TGCCCAGC*TGGAACGCCTCGAAGTGCAGGCAGAAGTACTGCCCAAAGCAGCTGAAAACCGTAAGCATCCATGTGGCGTTCTCAACTTcatgaggatttg
atttgacc
page-top