Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4986  (registered. 2012)
Contig Information
Length 1344 bp
Clones alternative view 15 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_RDr Root of dessiccated seed 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115446831|ref|NP_001047195.1|| Os02g0572400 [Oryza sativa (japonica cultivar-group)]
Score 663
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4986
TGCTCATAATTGTATTCGATTTTGTATATTTACAATAATGTGTTTGTAAAATCTGGGAATTACAAATTAACTATGGGACAATTGGATAATAATTATTATT
ACTGGCCAAATATTTATATTTCCACCTATCATGGCCTCGAAAACAATTAACCTGGAACATATGGATTGAAATAATCCCAGAAACTCAACTGTAGAAGAAT
ATCATCAGATAAAAATGTGAATGGAAGCAAGTCCAGTTGGCCTAGCGCTTCTAATCTGTTCCGTTGCTTTGGGTCGGATGGTCAATTGGAGTATACATGC
CCCATTTTCGTTCTTTTGGTCTCCAAGTATCTCTGATTCTCAGTGGTTATTGGAGTTACCAAGGGCACCCTACCAACAATGCTCAACCCGTAACCCTTCA
GACCAACATATTTGGCAGGATTGTTAGTCATCAACTTCATTGAACGGACTCCTAGATCACGTAATATCTGTGCACCGATCCCATATTCCCTCGAGTCCAC
AGGCAGTCCTAGTTCCTCGTTAGCCTCCACAGTGTCACGTCCTTCGTCTTGTAAGTTATAAGCACGAAGCTTGTGACCCAGACCAATGCCCCTCCCTTCA
TGCCCACGAAGATAAACTAGTACACCCCTTCCAGCCTTCTCAATCCTCTCCATTGACATTGCAAGCTGGTCACCACAATCACATCTTGCTGATCCAAAAA
TGTCTCCTGTGAGACACTCGGAATGGACCCTCACAAGAATATCTTGACCATCTCCAATCTCACCTTTCACCATTGCGATATGCTCGATCCCATCAATAAC
AGATCTGTAGCAGTAAGCACGGACATTGCCCCATCTCAAAGGTAAGCGTGCAACAGATGCACGTTCAATTAGTCTGTCTCTTTTTCTCCTATATCTAATC
AAGTCAGCAATCGATACGATCTTCAAATTATTCTTTTCAGCAAACACGCGCAGCTTGGGTAAGCGAGCCATGGACCCATCCTCATCCACAATCTCACAGA
GTACTCCAACAGGAGGTAACCCAGCCAGCACAGCAAGATCAACAGATGCTTCAGTGTGTCCAGCTCGTTTGAGAACACCCCCGTCTCTGTACTTCAGAGG
GAAAATATGGCCAGGCCGATTGAAATCTTCAGGCTTTGAGTAAGGAGATGCAAGAGTCATGACTGTCTTTGCCCTATCCTTTGCAGATACCCCAGTCGTT
GTGCCTTCTTTAGCATCCACAGTAATGGTGAAAGCAGTACATAGCTTCTCCTCATTTTCCTTTGTTGAAACCATCAAAGGAAGGTTCAATCTTTCCAGAT
CATTTTCTTTCATGCTAACACACACAATTCCTGTGCTATGCCTT
page-top