Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4975  (registered. 2012)
Contig Information
Length 644 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_RDr Root of dessiccated seed 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226493713|ref|NP_001141685.1|| hypothetical protein LOC100273812 [Zea mays]
Score 186
Evalue 1.00E-45
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4975
AAAATGCATAGCGTCAGTGACGAAGAACCGATGCACCGTAGTTACTACTACAGGAGACCATAGCAATCATACAGACATACGTGCATTGCTACGTACGTAC
GTACATACACATGAACAGATTAGCGCGCCGGAGCAACAACCGATTACCATCCAAATAATAATACACCACGTATCTAACCAGCCTGAGCTGCATGAACAGC
ATGCATCGCCAAATAAAAGACAGTCGGAATGAGCATCTAGTTTATGAAAATTGGCGCCTAAATAAGGAGTCATGCTAAGTTGATCAGCATCTAGTTTGGT
GCTTCGTCCAAGATCCATCTCAATACATCTTACTGGACTAATCTTCACATCTCATCACCACTACTGATTACGAGCTCACCATGTTGAACTGGAACCTGGA
CAGCTGCTGCGGGATGGTGGAAATCACTGGTCCATACCGCTGAACATTGTCATACAGTTCAAACAGTGGAACAGCAAGTAGCTTCAAGTTCCTTGGAACA
GCAAAATACTCCCTTTCAGTTAGGTGAACAATGAAAAGCTTCTTGCACTCCTTGGGCTTTGTTATATGTGGAGGGCAGTAAGGATACATCACGGTNNNNN
NNNTTGGCCTCCACCATTCAGCAACACACTCTCCAACCTGCCAG
page-top