Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4967  (registered. 2012)
Contig Information
Length 1692 bp
Clones alternative view 28 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 2
Wh_VHS Shoot with heat shock treatment 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XF Seedling, infected with leaf rust 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125591759|gb|EAZ32109.1|| hypothetical protein OsJ_16304 [Oryza sativa Japonica Group]
Score 868
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4967
TGGGACTAAAATAAAACCTGGAAGCGAGACTACCAACTGCTCCCTTAGGAGTAGAGATAACAAAGGGGAATAATCACTGCCAGCAGTAGCGAGCATTCTG
AAATCTGAACCATATCAACAAGTCGCAGAAACCTCGACTAATCACTCAGCTAAGATGCGCAATGTCGACCTCATCAGGTAACTTGAAGGTATCCGCAGCC
CCAAACTTCTTCCTCCCCTCCTTCCACTCGTCCTCATCCTCCAGGCTGTCGCTGTCGTCGTTCTCGTGCCCATGGCTTGATGGAGTCGCGGGCTCCTCGA
CGCTCTTCGACTTGCAGTGGCCGTTGGCGAGCATGGTGACCTGACGGAGGTGGGAGATCTCGACGACGACAGTCTCGTCGTTGCTGGGGAGTGGCTGCTT
CCATGGCTCACCGTCGACCCTCATGAACGTGTGGTCGGCTGCTCCTTTGTGGAACTCGAACCGGATTCTATGAGCCTGTGCTAGACGAGTCCCGTGTCCA
TTAGGGGCCAGCAATACGAGACCGTGCCAAGCATCACGAAAGCCGACAACCTCAATGAGTCCATCATCAACATAAGGCGCAGTCAGGTCCCTGTCTTGTT
TCTTCCTCGTGCCAGGGGTTCCCCAGGGATTGAATCCTCCCGAAAAACTTGGCAAATTGAGGCAGATAATTGATCGAATACTGCTCGGGATTTTAAGCTC
TTCCCATTTGCCACCAATTTTCATGATCTTCACCTTTGCAAGTTGCGAAATGTTCCTTGAAGAGGAATGGGTTAGGGAAGGAGCAAACCATCCTTGTTTA
AGTCCAAGCTTAGCATATGTACCCTGATTCGTTAGCTGGTTTTTGAACTTCTCTGGATTTTTCTTCCTTTCAGAGTGGAACCCATATGACACTTGAGCAT
CCATTCCCATACTAAAGTAATTCCAAAATCCTCCACGGAATGTGTGGTAACCCTCCACATTGAGCTCATCGGATCCAGTTACACGGTGGAATGCATGAAG
TGAATGAGGCAGCTCTAAGGGAGCAATAGGATCACATGGACCTTCCTGTGGTACTCGCATCCTCATGATGATATGCCAACTATCAATGCGCATTTCTCTT
GCTCCTTTTACTAGCCCAAGGAATGATTTCACTGCCTCTTGGTCAGTAGCTGGGTTCTTCTTTCCCCATCCGAATGAAAAAGGAAGGTTGTTTCCGGTTC
CCAGAGGCACAGTAGCAACAGGGGGTGAGTGCGTAAGCTTCAGATCACTAACTACTCCAAGCAGCCAACTTGCCGTGCCATCACCACCAGCAACAATTAG
TCTCAGGCTCTTCTCAATTTGAATAGCAAGAGTGTCAGCATTGGACTTGAGCCTTTGGAAGTTGGCATACAACCTGTGCAGCACCTTGTCAGGGGACTCC
TCAGACAGATCAAAGACCTGTGCTTCATTGAGAACTTCACGGTATGATTTGATCAAACCACTTCCAAGTTGGCCACCGCTTCTAGAGTTGATGAAGACTA
CCACGGGACAAGATGGTGCATTGTCAAGGATGACTGGTTCAGAGTCCGGCTTTAGTATGTAATCTGGAATGCGGTAGTCCGACAGCGGGCCGCATGACTT
GCTGCCAGAACCGTTAGAACCAATTGCGCATCCATCCATCCTGCAGTCCATCCTGGTGGCGGGGGAGGCTGGGCGCGTCCGGCGGATTCGGT
page-top