Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4956  (registered. 2012)
Contig Information
Length 1512 bp
Clones alternative view 14 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 3
Wh_yd Spikelet at late flowering 2
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_OKCS Seed DPA5 1
Wh_RDr Root of dessiccated seed 1
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|51090740|dbj|BAD35220.1|| putative nucleolar GTP-binding protein [Oryza sativa Japonica Group]
Score 656
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4956
TATAAAATCCTTGTTCATGAATAAGCCTCTGGTCATTGTGTGCAACAAGACTGATTTGCAGCCGCTTGATGGGCTTTCTGAAGATGACATGAAGCTAGTA
ATGGAGATGAAGTCAGAGGCTATGAAGACTATACCTCAAGGTGGAGATCCTAGTGAAGAGGGTGTTTTGTTGACTATGAGTGCTTTAACAGATGAGGGTG
TGATGGCTGTTAAAAATGCTGCATGTGAGAGGCTTCTTGAGCAGAGGGTGGAGATCAAGATGAAATCAAAGAAGATCAATGACTGCTTAAACAGGTTTCA
TGTTGCTATGCCCAAGCCTCGTGACAACAGAGATAGGCCTACTTGCATTCCTCAGGCTGTTCTTGAAGCTCAAGCGATTGCTGCTGCAAAGGAAAAGAAG
AAACTTGAGAGGGACCTTGAGAATGAGAATGGAGGTGCTGGTGTCTATTCCGCCAGTCTCAAAAAGCATTACTTGTTGGCTGATGATGAGTGGAAGGAAG
ATATTCTCCCTGAGATATTGGATGGGCATAATGTTGCTGATTTCCTGGATCCGGATATCTTGGAAAGGTGTGAGGAGCTGGAAAGGGAGGAGGGTCTTCG
TCTTGAAGAAGAAGCTGCTCAAGATGCTTTCATGATTGATGGCCATGATGAATTAACTGAAGAACAGCGTGAGATATTGGGTAAGATTAGGAAGAAGAAG
GCTATGCTCATCCAAGAGCATAGGATGAAGAAGAGCACTGCAGAGAGCCGTCCTATTGTTCCAAGGAAGCATGACAAGGATAGGAAGTTCACAACCAAGA
GACTGGGCAGGCAACTCACATCCATGGGTGTTGATCCTACTGCTGCTGTGAACCGACTTCGCAGCCAGTCAAGAGGCCGTAAGCGTGAGAGGTCACTGAG
CAGAGCTGATGGTGATGATGCTATGGAAGTTGATGGCCAGCACTCTGACAAGAAGCTGCGTATGAGGTCGAGGTCTAGGTCCAAATCACGACCAATTGAA
GAGGTTGTACCAGGTGACGGGATCCGGGATGTTGCTCAAAAGAAGAAGGCCATCAAGAAATCGAGGGACTCTGTCAAGAACAGGAACAAGGAGGCTCGCC
GTGGAGAGGCGGATCGCGTCATCCCCACCTTGAAACCGAAGCATCTCTTCTCTGGAAAACGAGGAGTTGGAAAGACCCAGAGGCGATAAACCAGTCAATG
TGGACGTTGCTGCTTGCAATCACTCGATCAGGAACTACAGGATCACTGCCATTTTCCGTGCTGGGCATCGCGGGAGGCTTCAGCACCAACCTGGCAGGAG
GAGATACTATTTACTGCATTTTTACTCGTGTCTGGCCTTTGCTCTCTGTTACGACGCTTGGTCCTCCTTTGTTAGACTATATATCGTTGCTGAACTACAT
GGTTGTACCTTCGGTTTACTCTGCACTTGTGCGGAGCGGAGTCAAATTTTGTTTTATGGTGTTATTAATGTATTTGAACGGGCCGCTTGTTTTCCTTTTA
ACAAAAAAAAAA
page-top