Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12393  (registered. 2002)
Contig Information
Length 642 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 5
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 353
Evalue 7.40414e-32
Total Hit Count 7
Registered year 2002
Contig Sequence     [ Download ]
>Contig12393
ttttttttttgATAAATCATGGACGCGATCGGTTTCCGATAACTATCCATACTCATACAGGTACAATCAATTTTCACACAGCAGGGTCCGAATCTTACAG
TACTTGCAGAGTTGCAGTTAGGCTCAGCCTCCAACTGGTGCACACTCATTGTCAACAAAAAGGAGGGGAAGAAAAATAACTCTTCATGTTCACAAAACGA
CCGTAGACGCCAGAGGCGCACTTCTCCGGAAGCTTTGAGCCGCTAGATTATGTTCTAACAGCTCGGGAAGGCGAGCCGGAGCAAGGGGACGAGAGAAAAT
CACGAGTCCGGCAAGACCTGCGCCTGGTCCTCGCGGCGTCCCTCGTCCTGCAGCTGCTGCGCCTCCTTCTCCTTGGCGAGCATGTGCGCTTCGTACCTCC
GCAGCCTCTCCTCCATCCTCACCTTGTAGGAGGTCTCGATGCGGTGCATGACGTAGAAGCCGAGGCCGCCGCCGAGGATGGTGCCGGCCATGATCCGCAC
GTACGCCCACCGCCGCGACCCGGGCGGCGCCATTTCTCACTGACTTTGCTACGCCGCCGCCGCCCGTAGAGGTGGATGGGGCGTCCGGCTCGACGGAGAT
GGGGTGT*CCGGAGCAGAGGAAGGGGAGGGGAGGGGGGCctc
page-top