Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12328  (registered. 2002)
Contig Information
Length 747 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 1
Wh_r Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit phenylalanine ammonia-lyase [Hordeum vulgare subsp. vulgare]
Score 702
Evalue 3.42527e-72
Total Hit Count 340
Registered year 2002
Contig Sequence     [ Download ]
>Contig12328
ttttttttttaCAAGCAAAAAAGAAGCCACATAGTATTAGCATGATTCACCCCAAAATACAACGACAATATCTTTAGGTAAAG*CTGCGGGGCCGCCATG
GCAGAGCAGCTACACAATCAACAACAACGCCACACGTCGATCAACACCAACGCACGAACAACGAAAGGCAAAAGGCGACAGGAATTGAAGAAGAAGAACA
TGCACGAACGAATTAAGCGTCTTATTTTTGGATGTACTCTGGAAGCCTCCTCCTCCTCTCCTCCACGGTGGCCCCGGCGATGCTTCAGACGTTGATGGGC
AGGGGCTCGCCGTTCCACTCCTTGAGGCACTCCAGCATGGGGTCGATGAGCTTGTTCTGGCTGATGCCCAGGAAGACCTTGGTGCACTCCTCGCCGGGGG
ACAGCAGCTTCTCGCCGGTGAGGTACACGCAGCCGAGCTCCTCGCGGACGAAGCGGTACAGCGGGAACGACCTGCTCTCCTTGATCAGGTTGGGGATGGG
CGCCGTGCCGTTCTCGAAGGCCACGCGGGCGGCCTCGATCTCCCGCGGCAGGGCCGACCGCAGCTCCTCCTCGAACTTGTTGATCTTGGAGAACACCGTG
GCCTCGCTCTCGGCCTCGCCGGCGCCGGCGGTCAGGGCGTGGTCGACCAGCACGGCGCGCAGCTTCTGCATCAGCGGGTAGTTGGCGCTGCAGGCGTCGT
CGGCGTAGCtgaacacggcctcgcggtcgatggcggtgatgaggctc
page-top