Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12313  (registered. 2002)
Contig Information
Length 641 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 1
Wh_r Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit kelch motif family protein [Oryza sativa (indica cultivar-group)]
Score 275
Evalue 8.10756e-23
Total Hit Count 21
Registered year 2002
Contig Sequence     [ Download ]
>Contig12313
gaaggggcagttgtaaccaagTGGCAGCAGTAGATAGAGCCATCTATCTATCTCTCTCTACAGGTATAAATCCTTCCTTGCTCGCTTGCTTGCTTGCTCG
CTCGCTCGCGCATCTGGTAGGACGGAGGGGGCAGAAGGAGTTGGTGGTGGGGATTTCTCGGGCGCCGCGGCGATGGGGGCGCGCTGATTGGGCcgccggc
cgcgatctctcagtCCAGATTTCTCCCTTTCCGGATCAGTCTCATCCGACAAGATAATAAGCCGAGCGGGAGGGGGAGAAGCCATGATGCTGGAGGGCAA
ATCCTGCCTCGTCTCGCGCTCCCTGCCCAGCTACTGCGACCCGGACTCCGACTGGGCGTTCCTCCTCAGCGGCAGCAAGCGGCCCGCGCCGGAAGACTTC
CGCGCGGAAGACATGGAGGAGGTAGACGCCGGCGGCAGCAGCAGCGGGAAGCGCAGCAAGTCGCCTTCCCCGCAGC*CGCACACGCCGGACATCACCGAG
AGCCACGGCTCCAGCCGCCATGCCTCCTCCGGCAGC***GGCGGAGGGGAGCAGCAAGGCTCTGGGGCCAATCTCATTGGCGAGATTGGCcgcgaCCTCT
CCATCAACTGCctcctccggctctccaggtcggactatggc
page-top