Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4945  (registered. 2012)
Contig Information
Length 1209 bp
Clones alternative view 89 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 1
Wh_r Root 1
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 5
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 5
Wh_OKCS Seed DPA5 4
Wh_RDr Root of dessiccated seed 6
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 3
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 6
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 7
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_CA 1
WH_XA Root 2
WH_XB Root 11
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|68655456|emb|CAJ01706.1|| S-adenosyl-L-homocysteine hydrolase [Hordeum vulgare subsp. vulgare]
Score 600
Evalue 8.00E-170
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4945
AGGAACCACACAAAATATGAGCTACAGCTTGCTAAGGATTTCAGGCATGGTAGAACAAACGAGACAAAACTGTATCTGGAAAAGCACACCTCCTCACTTA
AACCAATAATAATGCCATTATTTCTGGGCAAAAGCAAACGCCGCCTCTCCCAACCCTCACAAGGCTCAAAACATAACCATAATAACAAATCCTCCGCCTA
AGAGACAGCATGTAAGATAATAGAAGGGAAACAGGATAGTTGATAGAGTTCCCGTTGGTGCCGCTGCTCCGACTCAGGCTCAGGCCAGCCGCTAGTCATG
CTGGACACACTAGTACCGGTAAGCCGCAGGCTTGTAAGGACCCTCAATTGGGATGCTAATGTAGTCAGACTGGGACTTGGTGAGCTTGGTCAGCCTGGCG
CCGAGCTTGCCCAAGTGGAGGGCCGCGACCTTCTCGTCCAGGTGCTTGGGGAGAACGTACACCTTCTTCTCATACTTGCCACTGGCCTTCTCGTTCCACA
ACTCAAGCTGAGCAATAACCTGGTTGGTGAATGAGCAGGACATGACAAAGCTGGGGTGGCCAGTGGCACATCCAAGGTTCATCAGACGACCCTCAGCAAG
AACAATGATGCCAGTCTTGGTCTCGGGGAAGACCCAACGGTCAGTCTGGGGCTTGATGGTGATGCGCTTGACACCAGGGTAGGTCTCAAGGCCGTTCATG
TCGATCTCATTGTCAAAGTGACCAATGTTGCAGACAATGGCGTTGTTCTTCATCTTCCTCATGTGGTCGACCATGATGATGTCCTTGTTTCCGGTGGTGG
TCACAAAGATGTCAGCCTCAGAGACAACATCCTCCAAGGTGAGGATCTGGATACCCTCCATCAGGGCCTGAAGGGCACAGATGGGGTCAATCTCTGTCAC
GATCACACGGGCACCAGCCTGCTTGAGTGCGGCGGCACAGCCCTTGCCAACATCACCGTAACCGCAGACCACGGCGACCTTGCCGGCGATCATAACATCA
GTGGCCCTCATAAGACCATCAGGGAGCGAGTGACGGCAACCGTAAAGGTTGTCAAACTTGCTCTTGGTGACGGAGTCGTTGACGTTGATGGCGGGGAAGA
GGAGGGTGCCGGACTCCTGCATCTGGTAGAGCCTCTTGACGCCGGTGGTGGTCTCCTCGGAGACACCGACGAGCCTCTCCTTCATCTTGCGGTACTTGCT
GGCGTCGGT
page-top