Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12304  (registered. 2002)
Contig Information
Length 1106 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_dL Crown of seedling 2
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_016426 [Oryza sativa (japonica cultivar-group)]
Score 398
Evalue 1.1975e-36
Total Hit Count 252
Registered year 2002
Contig Sequence     [ Download ]
>Contig12304
gaaatggcctaggattaataaaccaTTGAAATCGCcaaatntgAGACGGCCGCACCAGAGTGGCAAACCAGGAAACAACGTATGCACTAATGCACAGCGC
ACAGCCCGTGTTACATAGACACCGTACAACCAGAAACTAGATTGCTAGACTACCATTAATTTGGACTTGCAAAATAGAGCAAGCTGTTGTGAACCATTCT
AATCTCTACCGGCAGTTTTACAAGATAACATCTCCTCTGCCTTTCATTCCACACGGGTGGAAGCTTCTAGCAAAGGGCACATTCCGTGCCCCTGTGAAAT
GTCATATTGTCCATACTAGACTAATGCAACCAAAAAATTCCTATGTTGCCGTGACGAAAGCTGCGCTCATTCTCAGCTTCAGAATCCATTCCTGAAGATC
AATTTTACACGTTCAGTCAATATCACATCCAAGATATATATATGGCTGTGCCCAAAGCTTTCTCACTTCCAGTCAAGCTTGCGGGCTTGAAAGTTTAGCA
TATTATGGATCTAGCCTTCATTGGAGCCAAACGTGATTCCTTATCCTTGTAGCTGCAAGGAAAGACCGGGTTGAAGCCAATTGATGGAGAAAAATGACTC
ATCCTGCTGTAGAAGGCTCAGAGTCGGTTGTTTTTGTTGTATCCTCAGCATCTTTCATACAGTCGTCTCCAGTTTGATGGCCAGAATCCAGGCTTtccag
ggcATGTTGTTGTTGATCTGGAGAGCCTGGGCTTGCCTTCCCTACATCATCGTTGCCGTCAGAATTGTTTATGCTTGAAGCAGGTGAGAGTGGTGACGGC
TTATCTTCTAGCTTGGGCTTCTTTAGAATATTCCCATCTGCATCTTTGCTGTCCAATGAGCTACGGCTTGCCATGGGTATATTTAAGGCTTCATCGGCTT
TTACGGGTCGCTTGGGAGATGGGTTATAATTTTTGTCAGAGTCATTATCCACAAGACCACCAGATTTAGGCCTTGTAGGGATGTGATGGATTTCACTTCC
ATTAGCTGGCTTAACCAGGCATTGTTGATGTGCATGtatggtCTGTGCAgcagaatcttcttcattgctgtctttactgaaataatcttcatcttcctta
tcaaga
page-top