Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4944  (registered. 2012)
Contig Information
Length 1740 bp
Clones alternative view 73 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_DPA20 Seed DPA20 2
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 6
Wh_V483 Shoot grown under cold condition for 3days 7
Wh_VABA Shoot with ABA treatment 12
Wh_VWD Shoot grown with dessication 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 5
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 3
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 7
WH_XE Seedling, infected with leaf rust 9
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115477551|ref|NP_001062371.1|| Os08g0538600 [Oryza sativa (japonica cultivar-group)]
Score 716
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4944
TTTTTTTTTTGACACTAAGTTTTTCTTTCGGTGGGGATCAACTCATACAACTCAGCTTCATACACTGCTACTACTGATAATAACTAATTACTCCCTCCGT
TCGGAATTACTTGTCGCAGAAATGGATATATCTAGACCTATTTTAGTTTTAAATACATCCATTTTCGAGACAAGTAACTCCGGACGGAGGGAGTACAAAG
CATCAGAAACTGATGGTCCATCGAAATGACATTGCTCACTGACTGGTGACTGCTTCTGTATATTAGCTAGTAATACTAGTATGACAAAAACACATCCATC
GTATAACTATGACGATTGATCCACGGCGATTGTTTCAGCTTCTCCAGTCCTCACCATTTGCATTGCACTCCATTAGCTAGGGGTAGATGATAATCTACTC
TTCACATGTTGCTAGACATCCATGCCGGTAGGCACCATGGGACTGGGAAACTGAAGCACAGGGATGGCGCCGGAGCTGGCTCCTGCGGCTCGGCCACGAG
GATGTAGACCAGGCCCATGACGCCGGTGTGCTGGCGCACGCTGCTGTAGTTGGAGACGATGGTCAGCACCTCACCGTCACTGACCTTGATGGATCCTGGC
TTAGGGTAGCACGTCGACATGCCAACGATGTAGTTCGCCTCGTTTCCTGCCTCCTTCCCTGTGCCGTAAGTTGGAAGCGATTCACAAAGAAGGCGTCCAT
CCTGGCCATGCAAAGAAGCACCAACTCCTCCGGAGTGCTGGTGCGCAACACTGAACACGATATCTCCTCCACGCGGCAAGGCCGCTCTAGCAGTCTTAGT
ATGGATGCACTCATTGTTGGCTCGGTTTTCTGCGCTGCATTCCTCGACTTGATACTCAACCTTGCAAGAATGTTCAGGAGTACCATCGAGCATAGCAGTA
TCCGTAACGTCAAATATGTAAATCTTGACAGGCACCACCGCATCAGTCCAGTCGAGCCACGTCACGGTGTACTGCAAGAACAACTTCCGCACCTCGCCAT
TGAACCCTTCTTTGACCCGACACTGGGTCTGATCATAGCAGCAAAATAGCCCACCAGTGTAGTTCTTTGAGATTGTGCGCCCATACTCATCAATTGTGAC
ATTGTAAAAGTCGCACTTGCACTCGGTGCAGCTAGGCTTGTCGACCACGCCCCTTGTGTCGATGGCATGAATATTGAGCAACCATTTCTCCTCATAGCCT
TCAGGGGCCTTGTCTTCATTGCCAATCTCAATTCCATAAGGATCAGGAACCCATGTGGCAGTGTGGCGAGTCTCGGAACCGAGCCCGAAGTACTGGCCTA
GTGTGGTCTTGCACACTCCATCATTCCTTTTAAGCATTCCTTTTGGAAGATTCTGCGTATCGGGGCTCTGACTGTTCTTCAGAGCATAGTATGGTTCTGC
AACCCAGTGATGCAGGTAAGTCTCATGGAGCGGGACAGGGACGCCATTCTCATCGACGACCTCTGCATCAAAGCTCTTGACTGCAAGGTGGCCTCGGGGG
AAGTCGACATCATGGTGGTACTTGTTTGAGACTGATCCAGGGCCCAGTAAGATGGGCGGAGAACGGAACGTCTTTGATTTAAGAAGATGGCCTCTCACGT
TGAGGGCTTCAGAGGGTAGGGGAGCAATAGCCGATAGGAGTGAAATGAGCAGCACAACAGAGCCAGCCATTTTCATCTTGTCACCAGCAGGAGGGATGGA
CGGAAGGGGGCCGAGGAGCAGGAGGAGGCGGAGGAGCTGC
page-top